ID: 1053922809

View in Genome Browser
Species Human (GRCh38)
Location 9:43015102-43015124
Sequence TTGGAGACTCAGAGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053922809_1053922817 16 Left 1053922809 9:43015102-43015124 CCCTCCCCGCTCTGAGTCTCCAA No data
Right 1053922817 9:43015141-43015163 TGTATGACTTTGTGTAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053922809 Original CRISPR TTGGAGACTCAGAGCGGGGA GGG (reversed) Intergenic
No off target data available for this crispr