ID: 1053926972

View in Genome Browser
Species Human (GRCh38)
Location 9:43071188-43071210
Sequence TCATTTCCACACAAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053926972_1053926975 19 Left 1053926972 9:43071188-43071210 CCATCTTCTTTGTGTGGAAATGA No data
Right 1053926975 9:43071230-43071252 TAATGTGTTTTCAATGGTGAGGG No data
1053926972_1053926973 13 Left 1053926972 9:43071188-43071210 CCATCTTCTTTGTGTGGAAATGA No data
Right 1053926973 9:43071224-43071246 GTCAGTTAATGTGTTTTCAATGG No data
1053926972_1053926976 20 Left 1053926972 9:43071188-43071210 CCATCTTCTTTGTGTGGAAATGA No data
Right 1053926976 9:43071231-43071253 AATGTGTTTTCAATGGTGAGGGG No data
1053926972_1053926974 18 Left 1053926972 9:43071188-43071210 CCATCTTCTTTGTGTGGAAATGA No data
Right 1053926974 9:43071229-43071251 TTAATGTGTTTTCAATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053926972 Original CRISPR TCATTTCCACACAAAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr