ID: 1053926974

View in Genome Browser
Species Human (GRCh38)
Location 9:43071229-43071251
Sequence TTAATGTGTTTTCAATGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053926972_1053926974 18 Left 1053926972 9:43071188-43071210 CCATCTTCTTTGTGTGGAAATGA No data
Right 1053926974 9:43071229-43071251 TTAATGTGTTTTCAATGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053926974 Original CRISPR TTAATGTGTTTTCAATGGTG AGG Intergenic
No off target data available for this crispr