ID: 1053928768

View in Genome Browser
Species Human (GRCh38)
Location 9:43093569-43093591
Sequence GGCACTGATGTGATGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053928768_1053928776 11 Left 1053928768 9:43093569-43093591 CCTGCTGGCATCACATCAGTGCC No data
Right 1053928776 9:43093603-43093625 GAGCTCAAAGAAGAAGGAGCTGG No data
1053928768_1053928775 5 Left 1053928768 9:43093569-43093591 CCTGCTGGCATCACATCAGTGCC No data
Right 1053928775 9:43093597-43093619 GGGATGGAGCTCAAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053928768 Original CRISPR GGCACTGATGTGATGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr