ID: 1053934628

View in Genome Browser
Species Human (GRCh38)
Location 9:43138662-43138684
Sequence CTTTCTGGGCAGAGGGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053934614_1053934628 18 Left 1053934614 9:43138621-43138643 CCTCTGTCTTCCTGTAACTCTTT No data
Right 1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG No data
1053934616_1053934628 8 Left 1053934616 9:43138631-43138653 CCTGTAACTCTTTCACCCTGGCC No data
Right 1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG No data
1053934617_1053934628 -7 Left 1053934617 9:43138646-43138668 CCCTGGCCCCTGTGCCCTTTCTG No data
Right 1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG No data
1053934618_1053934628 -8 Left 1053934618 9:43138647-43138669 CCTGGCCCCTGTGCCCTTTCTGG No data
Right 1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG No data
1053934613_1053934628 19 Left 1053934613 9:43138620-43138642 CCCTCTGTCTTCCTGTAACTCTT No data
Right 1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG No data
1053934612_1053934628 23 Left 1053934612 9:43138616-43138638 CCTTCCCTCTGTCTTCCTGTAAC 0: 9
1: 0
2: 2
3: 60
4: 583
Right 1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053934628 Original CRISPR CTTTCTGGGCAGAGGGTGAC AGG Intergenic
No off target data available for this crispr