ID: 1053942880

View in Genome Browser
Species Human (GRCh38)
Location 9:43270108-43270130
Sequence TCCCTGAAGGACAGTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053942880_1053942885 -8 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942885 9:43270123-43270145 TTCAGGGATGTCCTAGAAAGGGG No data
1053942880_1053942887 20 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data
1053942880_1053942883 -10 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942883 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
1053942880_1053942884 -9 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942884 9:43270122-43270144 CTTCAGGGATGTCCTAGAAAGGG No data
1053942880_1053942888 21 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942888 9:43270152-43270174 TGCTTCAGCTGTCCACTTTTGGG No data
1053942880_1053942889 24 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053942880 Original CRISPR TCCCTGAAGGACAGTGGTGA AGG (reversed) Intergenic