ID: 1053942881

View in Genome Browser
Species Human (GRCh38)
Location 9:43270114-43270136
Sequence AGGACATCCCTGAAGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053942881_1053942889 18 Left 1053942881 9:43270114-43270136 CCACTGTCCTTCAGGGATGTCCT No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data
1053942881_1053942887 14 Left 1053942881 9:43270114-43270136 CCACTGTCCTTCAGGGATGTCCT No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data
1053942881_1053942888 15 Left 1053942881 9:43270114-43270136 CCACTGTCCTTCAGGGATGTCCT No data
Right 1053942888 9:43270152-43270174 TGCTTCAGCTGTCCACTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053942881 Original CRISPR AGGACATCCCTGAAGGACAG TGG (reversed) Intergenic