ID: 1053942882

View in Genome Browser
Species Human (GRCh38)
Location 9:43270121-43270143
Sequence CCTTTCTAGGACATCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053942882_1053942888 8 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942888 9:43270152-43270174 TGCTTCAGCTGTCCACTTTTGGG No data
1053942882_1053942891 27 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942891 9:43270171-43270193 TGGGCGGTACCTGCCTATTGTGG No data
1053942882_1053942887 7 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data
1053942882_1053942889 11 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053942882 Original CRISPR CCTTTCTAGGACATCCCTGA AGG (reversed) Intergenic