ID: 1053942887

View in Genome Browser
Species Human (GRCh38)
Location 9:43270151-43270173
Sequence GTGCTTCAGCTGTCCACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053942882_1053942887 7 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data
1053942880_1053942887 20 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data
1053942881_1053942887 14 Left 1053942881 9:43270114-43270136 CCACTGTCCTTCAGGGATGTCCT No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data
1053942886_1053942887 -6 Left 1053942886 9:43270134-43270156 CCTAGAAAGGGGCTGCAGTGCTT No data
Right 1053942887 9:43270151-43270173 GTGCTTCAGCTGTCCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053942887 Original CRISPR GTGCTTCAGCTGTCCACTTT TGG Intergenic