ID: 1053942889

View in Genome Browser
Species Human (GRCh38)
Location 9:43270155-43270177
Sequence TTCAGCTGTCCACTTTTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053942881_1053942889 18 Left 1053942881 9:43270114-43270136 CCACTGTCCTTCAGGGATGTCCT No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data
1053942882_1053942889 11 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data
1053942886_1053942889 -2 Left 1053942886 9:43270134-43270156 CCTAGAAAGGGGCTGCAGTGCTT No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data
1053942880_1053942889 24 Left 1053942880 9:43270108-43270130 CCTTCACCACTGTCCTTCAGGGA No data
Right 1053942889 9:43270155-43270177 TTCAGCTGTCCACTTTTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053942889 Original CRISPR TTCAGCTGTCCACTTTTGGG CGG Intergenic