ID: 1053942891

View in Genome Browser
Species Human (GRCh38)
Location 9:43270171-43270193
Sequence TGGGCGGTACCTGCCTATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053942886_1053942891 14 Left 1053942886 9:43270134-43270156 CCTAGAAAGGGGCTGCAGTGCTT No data
Right 1053942891 9:43270171-43270193 TGGGCGGTACCTGCCTATTGTGG No data
1053942882_1053942891 27 Left 1053942882 9:43270121-43270143 CCTTCAGGGATGTCCTAGAAAGG No data
Right 1053942891 9:43270171-43270193 TGGGCGGTACCTGCCTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053942891 Original CRISPR TGGGCGGTACCTGCCTATTG TGG Intergenic