ID: 1053945879

View in Genome Browser
Species Human (GRCh38)
Location 9:43310605-43310627
Sequence CGGCAAAAAGCCGCGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053945879_1053945883 -10 Left 1053945879 9:43310605-43310627 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1053945883 9:43310618-43310640 CTTTTTGCCGCTACCGCCGCGGG No data
1053945879_1053945889 28 Left 1053945879 9:43310605-43310627 CCTGCCACCGCGGCTTTTTGCCG No data
Right 1053945889 9:43310656-43310678 GCTTTTTGCCACCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053945879 Original CRISPR CGGCAAAAAGCCGCGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr