ID: 1053946054

View in Genome Browser
Species Human (GRCh38)
Location 9:43311341-43311363
Sequence CGGCAAAAAGCCGTAGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053946054_1053946065 27 Left 1053946054 9:43311341-43311363 CCCGCCACTACGGCTTTTTGCCG No data
Right 1053946065 9:43311391-43311413 GCTTTTTGCCCTCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053946054 Original CRISPR CGGCAAAAAGCCGTAGTGGC GGG (reversed) Intergenic
No off target data available for this crispr