ID: 1053946177

View in Genome Browser
Species Human (GRCh38)
Location 9:43311929-43311951
Sequence CCGCAAAAAGCAGCGGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053946177_1053946182 0 Left 1053946177 9:43311929-43311951 CCCGCCACCGCTGCTTTTTGCGG No data
Right 1053946182 9:43311952-43311974 CTTTTTGCCCCCCACCGCCACGG No data
1053946177_1053946190 21 Left 1053946177 9:43311929-43311951 CCCGCCACCGCTGCTTTTTGCGG No data
Right 1053946190 9:43311973-43311995 GGCTTTTTGCCCCGCCACTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053946177 Original CRISPR CCGCAAAAAGCAGCGGTGGC GGG (reversed) Intergenic
No off target data available for this crispr