ID: 1053946192

View in Genome Browser
Species Human (GRCh38)
Location 9:43311983-43312005
Sequence CGGCAAAAAGCCGTAGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053946192_1053946196 5 Left 1053946192 9:43311983-43312005 CCCGCCACTACGGCTTTTTGCCG No data
Right 1053946196 9:43312011-43312033 GCTTTTTGCCCCCGAAGCCACGG No data
1053946192_1053946202 27 Left 1053946192 9:43311983-43312005 CCCGCCACTACGGCTTTTTGCCG No data
Right 1053946202 9:43312033-43312055 GCTTTTTGCCCTCACCGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053946192 Original CRISPR CGGCAAAAAGCCGTAGTGGC GGG (reversed) Intergenic
No off target data available for this crispr