ID: 1053967289

View in Genome Browser
Species Human (GRCh38)
Location 9:43667909-43667931
Sequence ATTCTACTCTGTGACTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053967289_1053967290 -3 Left 1053967289 9:43667909-43667931 CCATTGAAGTCACAGAGTAGAAT No data
Right 1053967290 9:43667929-43667951 AATGTTCCCTTTTATATACCAGG No data
1053967289_1053967294 25 Left 1053967289 9:43667909-43667931 CCATTGAAGTCACAGAGTAGAAT No data
Right 1053967294 9:43667957-43667979 GACACTCTTTCTGCGCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053967289 Original CRISPR ATTCTACTCTGTGACTTCAA TGG (reversed) Intergenic
No off target data available for this crispr