ID: 1054021973

View in Genome Browser
Species Human (GRCh38)
Location 9:44615714-44615736
Sequence ATTCTACTCTGTGACTTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054021973_1054021977 25 Left 1054021973 9:44615714-44615736 CCATTGAAGTCACAGAGTAGAAT No data
Right 1054021977 9:44615762-44615784 GACACTCTTTCTGCGCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054021973 Original CRISPR ATTCTACTCTGTGACTTCAA TGG (reversed) Intergenic
No off target data available for this crispr