ID: 1054087439 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:60759759-60759781 |
Sequence | AGTTATTCGCAGAAGATGGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1054087436_1054087439 | 4 | Left | 1054087436 | 9:60759732-60759754 | CCAAGAGTTGTTTCTCAAAAGGA | 0: 6 1: 30 2: 252 3: 273 4: 455 |
||
Right | 1054087439 | 9:60759759-60759781 | AGTTATTCGCAGAAGATGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1054087439 | Original CRISPR | AGTTATTCGCAGAAGATGGC AGG | Intergenic | ||
No off target data available for this crispr |