ID: 1054087439

View in Genome Browser
Species Human (GRCh38)
Location 9:60759759-60759781
Sequence AGTTATTCGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054087436_1054087439 4 Left 1054087436 9:60759732-60759754 CCAAGAGTTGTTTCTCAAAAGGA 0: 6
1: 30
2: 252
3: 273
4: 455
Right 1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054087439 Original CRISPR AGTTATTCGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr