ID: 1054087636

View in Genome Browser
Species Human (GRCh38)
Location 9:60761422-60761444
Sequence TGTCATGAGAACAGCACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2224
Summary {0: 22, 1: 146, 2: 334, 3: 744, 4: 978}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054087636_1054087642 18 Left 1054087636 9:60761422-60761444 CCCTTGGTGCTGTTCTCATGACA 0: 22
1: 146
2: 334
3: 744
4: 978
Right 1054087642 9:60761463-60761485 GATCTGGCTGTTTAAAAGTGTGG 0: 12
1: 60
2: 163
3: 424
4: 628
1054087636_1054087640 2 Left 1054087636 9:60761422-60761444 CCCTTGGTGCTGTTCTCATGACA 0: 22
1: 146
2: 334
3: 744
4: 978
Right 1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054087636 Original CRISPR TGTCATGAGAACAGCACCAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr