ID: 1054087640

View in Genome Browser
Species Human (GRCh38)
Location 9:60761447-60761469
Sequence GGGTGCCTTCTCATGAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054087635_1054087640 7 Left 1054087635 9:60761417-60761439 CCATTCCCTTGGTGCTGTTCTCA No data
Right 1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG No data
1054087637_1054087640 1 Left 1054087637 9:60761423-60761445 CCTTGGTGCTGTTCTCATGACAG No data
Right 1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG No data
1054087636_1054087640 2 Left 1054087636 9:60761422-60761444 CCCTTGGTGCTGTTCTCATGACA 0: 22
1: 146
2: 334
3: 744
4: 978
Right 1054087640 9:60761447-60761469 GGGTGCCTTCTCATGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054087640 Original CRISPR GGGTGCCTTCTCATGAGATC TGG Intergenic
No off target data available for this crispr