ID: 1054087770

View in Genome Browser
Species Human (GRCh38)
Location 9:60762686-60762708
Sequence TGTACACAGCTGAAAGTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054087770_1054087774 26 Left 1054087770 9:60762686-60762708 CCACGCACTTTCAGCTGTGTACA No data
Right 1054087774 9:60762735-60762757 TCTGTTTTTCACTTTCAGTATGG 0: 16
1: 22
2: 18
3: 66
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054087770 Original CRISPR TGTACACAGCTGAAAGTGCG TGG (reversed) Intergenic
No off target data available for this crispr