ID: 1054097725

View in Genome Browser
Species Human (GRCh38)
Location 9:60917125-60917147
Sequence CTTCACTGCTCCTCCCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054097717_1054097725 15 Left 1054097717 9:60917087-60917109 CCTGATCCTCTGGCCTGCTCTCT No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097716_1054097725 16 Left 1054097716 9:60917086-60917108 CCCTGATCCTCTGGCCTGCTCTC No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097718_1054097725 9 Left 1054097718 9:60917093-60917115 CCTCTGGCCTGCTCTCTGCCTCC No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097714_1054097725 24 Left 1054097714 9:60917078-60917100 CCACACACCCCTGATCCTCTGGC No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097711_1054097725 28 Left 1054097711 9:60917074-60917096 CCCACCACACACCCCTGATCCTC No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097721_1054097725 -9 Left 1054097721 9:60917111-60917133 CCTCCTCCAAAAGGCTTCACTGC No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097712_1054097725 27 Left 1054097712 9:60917075-60917097 CCACCACACACCCCTGATCCTCT No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097715_1054097725 17 Left 1054097715 9:60917085-60917107 CCCCTGATCCTCTGGCCTGCTCT No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data
1054097719_1054097725 2 Left 1054097719 9:60917100-60917122 CCTGCTCTCTGCCTCCTCCAAAA No data
Right 1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054097725 Original CRISPR CTTCACTGCTCCTCCCCTGC GGG Intergenic
No off target data available for this crispr