ID: 1054098081

View in Genome Browser
Species Human (GRCh38)
Location 9:60919200-60919222
Sequence CAGCTGGACAGGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054098073_1054098081 -8 Left 1054098073 9:60919185-60919207 CCTTGAAGCCTCCTCCAGCTGGA No data
Right 1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG No data
1054098068_1054098081 26 Left 1054098068 9:60919151-60919173 CCGCGAGGAATCCCATCTTGGAA No data
Right 1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG No data
1054098069_1054098081 15 Left 1054098069 9:60919162-60919184 CCCATCTTGGAATGATCATGAAC No data
Right 1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG No data
1054098071_1054098081 -7 Left 1054098071 9:60919184-60919206 CCCTTGAAGCCTCCTCCAGCTGG No data
Right 1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG No data
1054098070_1054098081 14 Left 1054098070 9:60919163-60919185 CCATCTTGGAATGATCATGAACC No data
Right 1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054098081 Original CRISPR CAGCTGGACAGGAGGGCAGG TGG Intergenic
No off target data available for this crispr