ID: 1054107796

View in Genome Browser
Species Human (GRCh38)
Location 9:61072102-61072124
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 3, 1: 1, 2: 6, 3: 29, 4: 282}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054107796 Original CRISPR CTCACTCCCCAGAGAGGGCG GGG (reversed) Intergenic
901100609 1:6715853-6715875 CTCACTTCCCAGACGGGGTGGGG + Intergenic
903779188 1:25810714-25810736 CTCCCTCCCCAGAGTGGGAAGGG + Intronic
904238892 1:29131357-29131379 CTCACTGCCCAGAGCCAGCGGGG + Intergenic
904360850 1:29970939-29970961 CCCACTCCAGAGAGAGGGCGAGG - Intergenic
905039994 1:34948032-34948054 CTCACTTCCCAGACTGGGCCGGG - Intergenic
905360321 1:37414806-37414828 CTCACACTCCAGAGAAGGTGGGG + Intergenic
906355972 1:45106264-45106286 CCCACCTCCCAGAGGGGGCGGGG - Intronic
906357016 1:45115525-45115547 CTCACATCCCAGACGGGGCGCGG + Intronic
906685160 1:47758509-47758531 CTTACTCCCTGGAGAGGCCGTGG - Intergenic
907427000 1:54386225-54386247 CTCGCTCCCCACAGAAGGAGGGG + Intronic
908131299 1:61078125-61078147 CTCAATAGCCAGAGGGGGCGGGG + Intronic
909108123 1:71438846-71438868 CTCACTGGCCAGTGATGGCGTGG + Intronic
909623070 1:77687422-77687444 CTCACTTCCTAGAGGGGGTGGGG - Intergenic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
910262559 1:85306328-85306350 CTGTCTCCCCAGAGATGGGGCGG - Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
911283921 1:95966345-95966367 CTCACTTCCCAGATGGTGCGGGG + Intergenic
912421175 1:109543340-109543362 CCACCTCCCCAAAGAGGGCGTGG - Exonic
913572238 1:120132069-120132091 TTCACTTCCCTGAAAGGGCGGGG - Intergenic
914293158 1:146293713-146293735 TTCACTTCCCTGAAAGGGCGGGG - Intergenic
914554202 1:148744496-148744518 TTCACTTCCCTGAAAGGGCGGGG - Intergenic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
914947395 1:152079345-152079367 GTCACTTCCCAGACAGGGCGGGG + Intergenic
915548156 1:156615270-156615292 CTTACTCCCCAGAGCGTGCAAGG - Intergenic
917348873 1:174056627-174056649 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
917411125 1:174761352-174761374 CTCACTTGCCAGACAGTGCGGGG + Intronic
921007729 1:211111549-211111571 CTCACTTCCCAGACGGGGCGGGG - Intronic
921007751 1:211111628-211111650 CTCACTTCCCAGACGGGGCGGGG - Intronic
921779829 1:219149607-219149629 CTCAGACCCCAGAGAGAGCCAGG - Intergenic
922306976 1:224352730-224352752 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
923323265 1:232857495-232857517 CTCATTCCCCTGAGAGGTCAGGG + Intergenic
1065122218 10:22541281-22541303 TTCACACCCCTGAGAGGGAGAGG + Intronic
1065435614 10:25701663-25701685 CGCAATCCCCAGGGAGGGCCGGG + Intergenic
1066026221 10:31362507-31362529 CTCACTGCCCAGACGGGGCAGGG + Intronic
1066026239 10:31362587-31362609 GTCGCTTCCCAGACAGGGCGGGG + Intronic
1066432182 10:35362804-35362826 CTCACTCCCCAGATAGTTGGCGG + Intronic
1067089865 10:43261110-43261132 ACCACTTCCCAGAGGGGGCGGGG - Intronic
1067175955 10:43945583-43945605 CTGACTCCCCAGAGGAGACGGGG + Intergenic
1067532057 10:47081136-47081158 CTGACTCCCAAGCGAGGGCAGGG - Intergenic
1070318752 10:75338586-75338608 GCCACTCCCCAGAGAGGTCAGGG - Intergenic
1070367404 10:75750465-75750487 CTCACATCCCAGACGGGGCGGGG + Intronic
1070367474 10:75750703-75750725 CTCACATCCCAGACGGGGCGGGG + Intronic
1070371019 10:75781981-75782003 CACATTCCCCACAGAGGGAGAGG - Intronic
1071341770 10:84655633-84655655 CTCACTTCCCAGACAGGGCAGGG + Intergenic
1071418119 10:85459961-85459983 CTCTCTCCCGAGAGAGAGAGGGG - Intergenic
1073473105 10:103735998-103736020 CTCACCCACCAGAGAGGTCCTGG - Intronic
1073878304 10:107950683-107950705 CTCACTGCCCGGAGCTGGCGGGG - Intergenic
1074772966 10:116745127-116745149 CTTACTTCCCAGTGGGGGCGAGG - Intergenic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1075799642 10:125145400-125145422 GTCAGTCCCCAGAGAGGCCCTGG - Intronic
1076124501 10:127963163-127963185 CTCCCACCCAAGAGAGGGCTGGG + Intronic
1076373002 10:129967015-129967037 CGCCTTCCCCAGAAAGGGCGAGG - Intergenic
1076648898 10:131973609-131973631 CTGCATCCCCAAAGAGGGCGAGG + Intronic
1076826849 10:132973616-132973638 CACACTCCCCAGAGGGGCCCGGG - Intergenic
1077017549 11:403604-403626 CTCCCTCCCCACAGTGGGCGGGG + Exonic
1077058851 11:609022-609044 CCCATTCCCCAGAGAGGAAGGGG + Exonic
1077131646 11:975943-975965 CACACTCCTCAGAGAGGAGGAGG - Intronic
1077194498 11:1272413-1272435 CTCATCCCCCAGCGAGGGCCTGG + Intergenic
1077487976 11:2847856-2847878 CGGCCCCCCCAGAGAGGGCGGGG + Exonic
1077583798 11:3435199-3435221 CTCACTGCCCAGGGACGGCGGGG + Intergenic
1078578096 11:12517980-12518002 CTCTCTCCCCAGAGATGACAAGG + Intronic
1080503087 11:32888423-32888445 CTCACTGCCCAGGGCTGGCGGGG + Intergenic
1080749355 11:35138646-35138668 CTCACTCCCCACTGTGGGCACGG + Intergenic
1080895590 11:36446655-36446677 CTCACTCCCCAGTGTGGTCCTGG - Intronic
1081997032 11:47372410-47372432 CTCACTCTCCAGCGAGGGGATGG - Intronic
1083299653 11:61733742-61733764 CTCACTGCCCAGCGAGGAGGCGG + Intronic
1083310373 11:61780756-61780778 CTCACTCCCCCCAGGGGGCTGGG - Exonic
1083729948 11:64647511-64647533 GCCCCTCCCCAGAGAGGGCAGGG - Intronic
1084240700 11:67817871-67817893 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
1084607561 11:70181309-70181331 CTCAGTCCCCACAGAGGGCAGGG + Intronic
1085277978 11:75312156-75312178 ACCACTCCCCGGGGAGGGCGAGG - Intronic
1085512432 11:77095206-77095228 CTCAAGGCCCAGAGAGGGCTGGG + Intronic
1085520776 11:77137861-77137883 CTCACTCCCCAGAGGCAGCCAGG + Intronic
1086728369 11:90218740-90218762 CTCACTTCCCAAACAGGGCAGGG - Intronic
1086728380 11:90218780-90218802 CTCAGTTCCCAGACTGGGCGGGG - Intronic
1087214716 11:95482466-95482488 CTCACATCCCAGACGGGGCGGGG - Intergenic
1088677206 11:112206143-112206165 CTCACTTCCCAGACAGGGCGGGG + Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1089180065 11:116577448-116577470 CTCACTCCCCAGTTAGCGCCCGG + Intergenic
1089329421 11:117679344-117679366 CTTCCTCCCCAGAGAGGGTCAGG + Intronic
1090259250 11:125306791-125306813 CTCAGTCCCCAGAGAGCCCATGG - Intronic
1090383415 11:126342761-126342783 CTCACTCCCCAGAGCTGTCGGGG - Intronic
1090669997 11:128939348-128939370 CTCACTCCCCGCAGAGGCAGGGG + Intronic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1091045043 11:132317880-132317902 CTCACTCCCCCAGGAGGGCTGGG + Intronic
1095561977 12:43576020-43576042 CTCACTCCCTACAGAGTGGGAGG - Intergenic
1096634297 12:52948921-52948943 CTCACCCCCCAGAAACGGGGTGG - Intronic
1097811927 12:64028417-64028439 CTCACACACCTGAGAGGCCGGGG - Intronic
1099890255 12:88580816-88580838 CTCGCGCGCCAGAGAGGGCTCGG + Intronic
1100586721 12:95987208-95987230 CTCTCTCCCCCGACAGGGCCTGG - Exonic
1101518539 12:105460160-105460182 TTCACTCCCAAGTGAGGCCGGGG - Intergenic
1102008908 12:109606309-109606331 CTCACTCCCCAGAGCCAGAGGGG - Intergenic
1102028688 12:109727756-109727778 CTCACTCCCCAGGGTAGGCTAGG + Intronic
1103021399 12:117537707-117537729 CCCAGTCCCCAAAGAGGGCCAGG + Intronic
1103927994 12:124434225-124434247 CTGACTCCCCAGTGGGGGTGAGG + Intronic
1104303960 12:127592633-127592655 CTCTCTCCCCTGAGAGAGAGGGG + Intergenic
1104799884 12:131547283-131547305 CTCACTCCCCATTGTGGGCTTGG + Intergenic
1106207738 13:27615358-27615380 AACACGCCCCAGAGAGGGCATGG - Intronic
1106536326 13:30647197-30647219 CTCACTGGCCAGATAGAGCGAGG - Intronic
1106601598 13:31192221-31192243 CACACTCCACAGAGTGGGAGTGG - Intergenic
1107793645 13:44028367-44028389 CTCTTTCCCAAGAGAGGGAGAGG - Intergenic
1110626571 13:77661084-77661106 CTCACTGCCCAGACGGGGCAGGG + Intergenic
1110626592 13:77661164-77661186 GTCACTTCCCAGATAGGGTGGGG + Intergenic
1113045085 13:106146828-106146850 CTCAATCCAAAGAGAGGGCATGG - Intergenic
1113331801 13:109334523-109334545 CTCCCTCTCCAGAGAGGGGCAGG - Intergenic
1114255753 14:21000181-21000203 CTCACTCTCCAGATAGGGGATGG - Intronic
1114559631 14:23580702-23580724 CTCACTGCCCAGCGCCGGCGGGG - Intergenic
1114636392 14:24189263-24189285 TTCCTTCCCCAGAGAGGGCCTGG - Exonic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120416667 14:84227876-84227898 CTCACATGCCAGAGAGGGAGAGG + Intergenic
1121617033 14:95320045-95320067 CTCACTCCCCCGTGCGGGGGCGG + Intergenic
1122367124 14:101200834-101200856 CTCACTCACCAAAGAGGGGATGG - Intergenic
1123051870 14:105547932-105547954 CTCACTGCCCAGGGCAGGCGGGG - Intergenic
1124100344 15:26687068-26687090 CTCACTTCCCAGAGTGGCAGGGG - Intronic
1125003731 15:34795851-34795873 CCCACACCCCAGAAAGGGGGAGG - Exonic
1125921462 15:43528052-43528074 CTCGATCCCCAGAGAAGGCAAGG - Exonic
1127569798 15:60230849-60230871 ATCACTCTTCAGAGAGGGCGTGG + Intergenic
1128213813 15:65920427-65920449 CCTACTCCCCACAGAGGGCCAGG - Intronic
1128843754 15:70871783-70871805 CTCACATCCCAGACGGGGCGGGG + Intronic
1129724400 15:77894228-77894250 CTCACTGCCCGGGGCGGGCGGGG + Intergenic
1129822930 15:78616984-78617006 CTGACAGCCCTGAGAGGGCGTGG + Intronic
1130543551 15:84839194-84839216 CTCCATCCCCAGAGAGTGCCTGG - Intronic
1131779976 15:95845759-95845781 ATCACACCCAGGAGAGGGCGGGG + Intergenic
1132221522 15:100108918-100108940 CACTCTCCCCAGACAGGGAGTGG - Intronic
1132350834 15:101138880-101138902 CTGACTCCCCAAAGAGGGGCTGG + Intergenic
1132902338 16:2264102-2264124 CCCACTCCCCACAGATGGCTCGG - Intronic
1133103096 16:3491021-3491043 CTCATTCCCCAGAGACGCAGAGG - Intergenic
1133161580 16:3915540-3915562 CCCACACCGCACAGAGGGCGGGG + Intergenic
1133352165 16:5108765-5108787 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
1134290653 16:12901331-12901353 CCTCCTACCCAGAGAGGGCGCGG + Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134750089 16:16618949-16618971 CTCACTTCCCAGACGGGGCGGGG + Intergenic
1134846667 16:17446593-17446615 CTCACTCCCAAGACTGGGAGGGG - Intronic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1135432386 16:22396615-22396637 TACACTCCCCAGAGAGGCAGAGG + Intronic
1138214470 16:55191132-55191154 CTCTCTCCTCACAGAGGGCCTGG - Intergenic
1138898611 16:61241055-61241077 CTCACTCCTCTGAGAGTGAGGGG - Intergenic
1142234169 16:88913772-88913794 ATGACTCCTCAGAGAGGGCTGGG + Intronic
1146943652 17:36860121-36860143 CCCGCTCCCCAGAGATGGAGTGG - Intergenic
1147137266 17:38441531-38441553 CTGAGGCCCCAGAGAGGGCGGGG + Intronic
1147602455 17:41754864-41754886 CTCACTCCCCAGGGAGCTCTGGG - Exonic
1149566267 17:57642860-57642882 ATCCCTCCCCAAAGAGGGCTGGG - Intronic
1149987449 17:61358154-61358176 CTGACTACCCAGAGACAGCGTGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151096941 17:71509340-71509362 GTCACTCCCCAAGGAGGGTGAGG - Intergenic
1151680144 17:75618884-75618906 CTCACTGCCCAGAGACCCCGTGG - Intergenic
1152366415 17:79859176-79859198 CTCCCTCCCCTGAAAGGGCAGGG - Intergenic
1152461585 17:80444852-80444874 CTCACTCCCCCGAATGGGGGTGG - Intergenic
1153514271 18:5890585-5890607 CGCACTCCCCGGGGAGGGCGGGG + Exonic
1160503871 18:79416724-79416746 TTCCCTCCCCAGAAAGGGAGGGG - Intronic
1160895949 19:1401821-1401843 CTCACACCCCAGCGAGGAGGGGG - Intergenic
1161212598 19:3075368-3075390 CTCCCTCCCCACTGAGGGTGTGG + Intergenic
1162033289 19:7926301-7926323 CCCACTCCCCGGCGAGGTCGTGG - Intergenic
1162155075 19:8671954-8671976 CTCTCTCCCCACAAAGGGCTGGG - Intergenic
1164017470 19:21265285-21265307 CTCCCTTCCCAGACAGGGCGGGG - Intronic
1164148994 19:22532659-22532681 CCCTCTTCCCAGAGTGGGCGGGG - Intergenic
1164155769 19:22596082-22596104 CCCTCTCCCCAGAGTGGGCGGGG + Intergenic
1166246268 19:41529184-41529206 CTCACTCTCCAGAATGGGCTTGG + Intergenic
1166267269 19:41691984-41692006 CGAACTCCCCAGAGAGAGAGAGG - Intronic
1166340133 19:42132454-42132476 CTCGGCCCCCAGAGAGGGTGGGG - Intronic
1167239427 19:48334293-48334315 CTTACTCCCCTGAGGAGGCGGGG + Intronic
1167300386 19:48674288-48674310 CTCAGTGTCCAGAGAGGGAGGGG + Intergenic
1167971146 19:53188162-53188184 CTCACTTCCCAGACGGGGTGGGG + Intronic
1168327223 19:55544616-55544638 GCCCCACCCCAGAGAGGGCGAGG - Intronic
1168464244 19:56589306-56589328 CACACTCCACAGAGAGGCCTTGG + Intergenic
929573626 2:43039009-43039031 ATCAGGTCCCAGAGAGGGCGAGG - Intergenic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932063094 2:68527762-68527784 GTCACTTCCCAGAGAGGGCGGGG + Intronic
932063133 2:68527922-68527944 CTCACTGCCCAGACGGGGCAGGG + Intronic
932063152 2:68528002-68528024 GTCACTTCCCAGAGAGGGCGGGG + Intronic
934589174 2:95530813-95530835 CTCACTCCTCAGAGCAGGCTTGG - Intergenic
936136303 2:109897190-109897212 CACACTGCCCTGAGAGGACGGGG + Intergenic
936208394 2:110474295-110474317 CACACTGCCCTGAGAGGACGGGG - Intergenic
937876645 2:126831000-126831022 CTGACTCCACAGAGAGGAAGTGG + Intergenic
938338306 2:130518460-130518482 CTCACTCCCCACAGGTGCCGGGG + Intergenic
938351533 2:130602290-130602312 CTCACTCCCCACAGGTGCCGGGG - Intergenic
942276787 2:174328846-174328868 GTCTGTCCCCAGAGAGGGGGAGG - Intergenic
944631547 2:201631100-201631122 CTAACCCCCCAGTGAGTGCGAGG + Intronic
945199501 2:207267052-207267074 CTCACTCCCCAAAGTGGGAGTGG + Intergenic
946168131 2:217877799-217877821 CTCACTGCCAGGAGAGGGCAAGG + Intronic
946285845 2:218701900-218701922 CTGATTCCCCAGAGAGAGCAAGG - Exonic
947723322 2:232381934-232381956 CTCAGTCCCCAGAGCGCACGGGG - Exonic
948123200 2:235546012-235546034 CTCACTCCTCACAGAAGGCAAGG - Intronic
948289876 2:236816952-236816974 GCCCCTCCCCAGAGAGGGCCAGG - Intergenic
948481688 2:238254321-238254343 CCCACTCCCCAGGGAGGCCATGG - Intronic
948523234 2:238554725-238554747 CTCATCCCCAAGTGAGGGCGGGG - Intergenic
948884861 2:240877461-240877483 CTCCCGCACCACAGAGGGCGGGG + Intronic
1169279821 20:4257408-4257430 CTCAATCCCCAAAGGGGGCAGGG - Intergenic
1170782018 20:19434295-19434317 ATCACTCCGCAGCGAGGGCTTGG + Intronic
1172279268 20:33699142-33699164 CTCACATCCCAGACGGGGCGGGG - Intergenic
1173868535 20:46328227-46328249 CTCACTCCCTGGTGAGGGAGGGG - Intergenic
1173984682 20:47251833-47251855 CTCACTTCCCAGATGGTGCGGGG - Intronic
1174200377 20:48802886-48802908 CTCACTCCCCAGCTTGGGCCAGG - Intronic
1175814373 20:61875890-61875912 CTCTCTCCCCAGGGCAGGCGGGG - Intronic
1176181652 20:63752341-63752363 CTCCCTCCCGAGGCAGGGCGGGG + Intronic
1176252972 20:64134367-64134389 CCCACTCCCCAGAAAGGATGAGG - Intergenic
1176389639 21:6156931-6156953 CCCAGTCCCCAGAGAGGAAGTGG + Intergenic
1177144670 21:17394501-17394523 CTCACTCCCTTGGGAGGCCGAGG - Intergenic
1177788296 21:25695653-25695675 CTCACTTCCCAGACGGGGCGGGG + Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179733829 21:43381307-43381329 CCCAGTCCCCAGAGAGGAAGTGG - Intergenic
1180183576 21:46128763-46128785 CTCACATCCCAGAGAGGCTGAGG + Intronic
1181658109 22:24318101-24318123 CTCACTTCCCAGACGGGGTGGGG + Intronic
1181961919 22:26628413-26628435 CTTACGCCCCAGAGTGGACGTGG - Exonic
1182446134 22:30390620-30390642 CAAACTCCCAAGAGAGGGTGGGG + Intronic
1183465817 22:37979958-37979980 CTCCCTCCCCAGGCTGGGCGGGG + Intronic
1183497146 22:38153340-38153362 CTCACTTCCCAGACAGGGCGGGG - Intronic
1183622212 22:38981176-38981198 CTCACTTCCCAGACGGTGCGGGG - Intronic
1183622223 22:38981216-38981238 CTCACTTCCCAGACGGTGCGGGG - Intronic
1183945439 22:41323280-41323302 CTCACTCCCCAAAATGGGAGAGG - Intronic
1184839221 22:47042882-47042904 CACCCTCCCCAGGGATGGCGAGG - Intronic
1185043560 22:48517829-48517851 GTGCCTGCCCAGAGAGGGCGGGG - Intronic
950110774 3:10417253-10417275 CTCACTTCCCAGAGAGTGTGGGG + Intronic
950621316 3:14207796-14207818 CTCTGTCCCCAGAGAGGTCCTGG + Intergenic
950678168 3:14567180-14567202 CTCACTCAGCAGTGAGGGCAAGG + Intergenic
952898745 3:38096052-38096074 CTCACTCCCCAAAGCCTGCGGGG - Intronic
953257546 3:41305868-41305890 CTCACATCCCAGACGGGGCGGGG - Intronic
953389240 3:42525125-42525147 TCCTCTCCCCAGAGAGGGAGAGG - Intronic
954701673 3:52453921-52453943 CTCACTCAGCTGAGAGTGCGGGG - Intronic
954751401 3:52816158-52816180 GTCACTGCCCACAGAGGACGAGG + Intronic
955449277 3:59049896-59049918 ATCACTCCCCAGGGACGGCCCGG - Intronic
956178625 3:66498426-66498448 GTAACTTCCCAGAGAGGGCAGGG - Intronic
956792099 3:72687943-72687965 ATCACTACCCTGAGAGGGCGGGG - Intergenic
961162919 3:124744896-124744918 CTCACTCTCCAAAGAGGGGAAGG + Exonic
963598455 3:147357146-147357168 CTTCCAACCCAGAGAGGGCGAGG + Intergenic
966411220 3:179648038-179648060 CTCAGTCCTCTGAGAGGCCGTGG + Intergenic
970580679 4:17471570-17471592 TTCACTCCCCAGAGAGGGGCAGG - Intronic
971593275 4:28496587-28496609 CTCACTCACCACAGAGAGTGAGG + Intergenic
972675751 4:41257726-41257748 CTCACGGCCCAGGTAGGGCGTGG + Exonic
977536505 4:98261185-98261207 CTCGCTCGCCACAGAGGGAGGGG + Intergenic
979846929 4:125525283-125525305 TTCACTTCCCAGAGAGGTAGGGG - Intergenic
981178729 4:141714265-141714287 CTCACCTCCAAGAGGGGGCGAGG - Intronic
982157471 4:152536079-152536101 CTCACTCCAGAGAGAGGGGCGGG + Exonic
985569999 5:639650-639672 GTCCCTCCCCAGAGAGGACTTGG + Intronic
985997818 5:3606501-3606523 CTCACTGCCCAGAAAGGGCCAGG - Intergenic
989977881 5:50607955-50607977 CCCACTTCCCAGACGGGGCGGGG - Intergenic
991267586 5:64740166-64740188 CTCTCTCCCTAGAGAGAGAGTGG - Intronic
991972830 5:72157542-72157564 GTCAGTCCCCAGGGAGGGTGGGG - Intronic
992024184 5:72654333-72654355 CTCTCTCCCCACAGAGGGAGGGG + Intergenic
993900722 5:93582744-93582766 CTCACACCCCAGAGGGGGAAGGG - Intergenic
994821166 5:104652756-104652778 GTCAGTCCCCAGGGAGGGCAGGG - Intergenic
994928809 5:106154413-106154435 CTCACTGCCCCGGGCGGGCGGGG - Intergenic
995421078 5:111967632-111967654 CTCACTTCCCAGACAGGGCGGGG - Intronic
999264964 5:150260862-150260884 TTCACTCCCCAGAGACCACGTGG - Intronic
999397937 5:151242369-151242391 CTCACTCCACAGGGTGGGAGGGG + Intronic
1001724402 5:173884948-173884970 CTCAAACCCCAGAGGGGGCTGGG + Intergenic
1001759114 5:174192927-174192949 CTCACTCTGCAGACAGTGCGCGG - Intronic
1002453441 5:179332257-179332279 GTGAGTGCCCAGAGAGGGCGTGG - Intronic
1002453985 5:179335865-179335887 GTGAGTGCCCAGAGAGGGCGTGG - Intronic
1002534519 5:179868921-179868943 CTGGCTCACCAGAGAGGCCGTGG - Intronic
1003397107 6:5762971-5762993 CGCACTCCCCAGAGGAGGAGAGG - Intronic
1003623959 6:7726546-7726568 CTCAGTCGCCAGGGAGAGCGCGG + Intergenic
1005243389 6:23855650-23855672 GTCACTTCCCAGACAGGGCGGGG - Intergenic
1005243407 6:23855730-23855752 CTCACTGCCCAGACGGGGCAGGG - Intergenic
1005583051 6:27251452-27251474 GGCGCTCCCCAGAGAGGGCGGGG + Intronic
1006299037 6:33184159-33184181 CTGTCTCCGCAGAGAGGGCAGGG + Intronic
1006831493 6:36970832-36970854 GTCACTGCCCAGAGAAGGCCTGG + Intronic
1009398278 6:63228071-63228093 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1009398436 6:63228795-63228817 GTCACTTCCCAGACAGGGTGGGG + Intergenic
1011068748 6:83359105-83359127 CTCACATCCCAGACAGGGCAGGG + Intronic
1011297199 6:85838557-85838579 CTCACATCCCAGATGGGGCGGGG - Intergenic
1013963451 6:115928292-115928314 CTCACTGCCCGGGGTGGGCGGGG + Intergenic
1014460264 6:121686664-121686686 CTCACTGACCAGGGTGGGCGGGG + Intergenic
1016385426 6:143526202-143526224 CTCACTCCTCAGAGATTGCTGGG - Intergenic
1017726028 6:157276427-157276449 TCCACTCCCCAGGGAGGGAGGGG + Intergenic
1017856023 6:158350190-158350212 CTCACTTCCTAGACAGGGTGGGG + Intronic
1018016199 6:159714454-159714476 TTCACTCCCCAGGCAGGGCCTGG + Intronic
1018963196 6:168463399-168463421 CTCATTCCCCAGTGAGGCCTGGG + Intronic
1020051579 7:5085484-5085506 CTCACACCTCAGGGAGGGAGTGG + Intergenic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1021493517 7:21246649-21246671 CTCACTTCCCAGACAGTGGGGGG + Intergenic
1021991836 7:26148107-26148129 CTCACCTCCCAGACGGGGCGGGG - Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1027661702 7:80995814-80995836 CACACTCCTGAGAGAGGTCGAGG + Intergenic
1027986748 7:85301973-85301995 CTCAATCCCCAGAGACAGCTGGG - Intergenic
1028303301 7:89228981-89229003 CTCACTGCCCAGTGCCGGCGGGG + Intronic
1029421467 7:100474080-100474102 CCCTCTCCACAGAGAGGGAGTGG + Intronic
1031022081 7:116638954-116638976 CTCACTTCCCAGACAGGGCCTGG - Intergenic
1031378308 7:121054148-121054170 CTCTCTCAGCAGAGAGGGCTTGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032892483 7:136213235-136213257 CTCACTTCCCAGATGGTGCGGGG + Intergenic
1033072191 7:138214355-138214377 CACACTCCCCAGGGTGGGAGTGG + Intergenic
1033073087 7:138222305-138222327 CACACTCCACAGAGCGGGAGCGG + Intergenic
1034822133 7:154225851-154225873 CTGACTCCACAGAGAGAGGGTGG - Intronic
1035336187 7:158128580-158128602 CTCCTTCCCCAGAAAGTGCGAGG + Intronic
1035669737 8:1408302-1408324 CTCACTCTCCAGAGTGTCCGAGG + Intergenic
1038441817 8:27575949-27575971 CTCAGACCCCAGAGAGAGCTGGG + Intergenic
1038461376 8:27720186-27720208 CTTACTTGCCAGAGAGGGTGAGG - Intergenic
1039864782 8:41490983-41491005 CTCCCTCGCCAGAGCAGGCGTGG - Intronic
1041851220 8:62395259-62395281 CTCACTTCCCAGACATTGCGCGG + Intronic
1044823737 8:96177350-96177372 CTCACTCCCTATACAGGGCTGGG - Intergenic
1045743348 8:105387540-105387562 CTCACTGCCTAGGGCGGGCGGGG + Intronic
1046773202 8:118137065-118137087 CACACTCCACAGAGTGGGAGTGG + Intergenic
1048068697 8:130999488-130999510 CTAACTCCCCAGAGTGGAGGTGG + Intronic
1048454475 8:134565613-134565635 GGCACTCCCCAGGGAGGGAGAGG + Intronic
1049234640 8:141506495-141506517 CTGAGTCCCCATAGAGGGGGCGG + Intergenic
1050139410 9:2502028-2502050 CACACTCCACAGAGTGGGAGTGG + Intergenic
1052413522 9:28149466-28149488 GTCACTTCCCAGAGAGGGCGGGG - Intronic
1052413542 9:28149546-28149568 CTCACTGCCCAGACGGGGCAGGG - Intronic
1053141489 9:35685331-35685353 CTCACTCCCCACAGGTGGCCAGG - Exonic
1053365736 9:37521299-37521321 CTCACTTCCCAGACAGCGTGGGG - Intronic
1053365747 9:37521339-37521361 CTCACTTCCCAGACAGTGTGGGG - Intronic
1053553436 9:39108273-39108295 CTCACTCCCCAGAGAGGGGGGGG - Intronic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1056884527 9:90428370-90428392 CTCCCTCCCAAAAGAGGGGGAGG + Intergenic
1057071815 9:92105681-92105703 GTCACTTCCCAGAGAGGGTGGGG - Intronic
1057505313 9:95628488-95628510 CTCTGCCCCCAGAGAGAGCGAGG + Intergenic
1057726907 9:97574325-97574347 CTCACTGCCCGGAGCCGGCGGGG - Intronic
1057789062 9:98110656-98110678 CTCACTCCCCACAGGGAGCAGGG + Intronic
1060527122 9:124326940-124326962 CGTACCCCCCAGTGAGGGCGGGG - Intronic
1062011903 9:134271895-134271917 TGCACTCCCCAGAGAGGCAGCGG - Intergenic
1062453228 9:136624168-136624190 CTCGGTCCCCAGAGAGGACAGGG + Intergenic
1187249531 X:17584293-17584315 CTCCCTCCCCAGGGAAGGGGTGG - Intronic
1191204148 X:57816676-57816698 CTCCCTCCATAGAGAGGGAGGGG + Intergenic
1195979060 X:110558809-110558831 CTCACTTCCCAGACAGTGTGGGG + Intergenic