ID: 1054119127

View in Genome Browser
Species Human (GRCh38)
Location 9:61192755-61192777
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 5, 1: 4, 2: 3, 3: 33, 4: 434}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054119119_1054119127 15 Left 1054119119 9:61192717-61192739 CCTGATCCTCTGGCCTGCTCTCT 0: 3
1: 6
2: 6
3: 36
4: 407
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119120_1054119127 9 Left 1054119120 9:61192723-61192745 CCTCTGGCCTGCTCTCTGCCTCC 0: 3
1: 4
2: 14
3: 134
4: 1003
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119118_1054119127 16 Left 1054119118 9:61192716-61192738 CCCTGATCCTCTGGCCTGCTCTC 0: 7
1: 0
2: 2
3: 19
4: 331
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119116_1054119127 24 Left 1054119116 9:61192708-61192730 CCACACACCCCTGATCCTCTGGC 0: 7
1: 0
2: 5
3: 41
4: 374
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119121_1054119127 2 Left 1054119121 9:61192730-61192752 CCTGCTCTCTGCCTCCTCCAAAA 0: 3
1: 3
2: 11
3: 55
4: 477
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119113_1054119127 28 Left 1054119113 9:61192704-61192726 CCCACCACACACCCCTGATCCTC 0: 7
1: 0
2: 4
3: 31
4: 335
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119123_1054119127 -9 Left 1054119123 9:61192741-61192763 CCTCCTCCAAAAGGCTTCACTGC 0: 6
1: 1
2: 8
3: 30
4: 285
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119117_1054119127 17 Left 1054119117 9:61192715-61192737 CCCCTGATCCTCTGGCCTGCTCT 0: 7
1: 0
2: 3
3: 42
4: 343
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434
1054119114_1054119127 27 Left 1054119114 9:61192705-61192727 CCACCACACACCCCTGATCCTCT 0: 7
1: 0
2: 4
3: 46
4: 415
Right 1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG 0: 5
1: 4
2: 3
3: 33
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900192835 1:1358688-1358710 CCACACTGCCCCTCCCCAGCAGG - Intronic
900639128 1:3680535-3680557 CTCCAGTGCTCCTGCCCTTCAGG + Intronic
900880339 1:5377007-5377029 CATCACTCCTCCCTCCCTGCAGG - Intergenic
901173374 1:7280278-7280300 CTTCAGTGTTCCTTCCCTGGTGG - Intronic
902032047 1:13430299-13430321 CTTCATTGCTCCTATCCAGCAGG + Intergenic
902916186 1:19641020-19641042 CCTCAGTGCTCCTCCCCATCAGG - Intronic
903528570 1:24012058-24012080 CCCCACTACTCCTGCCCTGCAGG + Intergenic
903576495 1:24342672-24342694 CCTCTCTCCTTCTCCCCTGCAGG + Exonic
903930487 1:26859244-26859266 CATTCCTACTCCTCCCCTGCTGG - Intergenic
905524080 1:38623502-38623524 CTTTCCTGCTCTTCCCCAGCTGG - Intergenic
906053210 1:42891962-42891984 CTGCACTGAAGCTCCCCTGCAGG - Intergenic
907137187 1:52150697-52150719 GCTCACTGCACCTCCCCTCCGGG - Intronic
907755581 1:57307444-57307466 CTTCCCCACTCCTCCCCAGCTGG + Intronic
907838566 1:58134642-58134664 CTTCACTGTCTCTCTCCTGCTGG - Intronic
909837850 1:80279976-80279998 CTTCAGGGCTTCTTCCCTGCAGG + Intergenic
911047406 1:93639771-93639793 TTTAAATGCTGCTCCCCTGCTGG - Intronic
913676601 1:121146765-121146787 CTTCACTGCTGCTGCTCAGCAGG + Intergenic
914028497 1:143934715-143934737 CTTCACTGCTGCTGCTCAGCAGG + Intergenic
914344583 1:146787748-146787770 TTTGACTGCTCCTGCCCAGCAGG + Intergenic
915301268 1:154952927-154952949 CTTCTCTCCTCCTCCCCTCCTGG + Intronic
915362696 1:155295424-155295446 CCCCACTGCTCACCCCCTGCAGG + Exonic
916248397 1:162710876-162710898 CTCAAATGCACCTCCCCTGCAGG - Intronic
916273890 1:162972670-162972692 CGTCTCTGCTCCTCAGCTGCAGG - Intergenic
918451518 1:184664071-184664093 CTTCAGAGCTCCTCTCCTCCGGG + Intergenic
919934650 1:202243573-202243595 CTGCTCTACACCTCCCCTGCAGG - Intronic
920463963 1:206165606-206165628 CTTCACTGCTGCTGCTCAGCAGG + Intergenic
920684041 1:208095579-208095601 CTTCCCTGCTCCTCCTCTGTGGG + Intronic
922339087 1:224641240-224641262 CTTCTCTTCCCCTCCCCGGCAGG - Intronic
922620248 1:226984338-226984360 CTTCACTGCCCCTCACCCCCAGG - Intronic
922920718 1:229300554-229300576 CTTGGTTCCTCCTCCCCTGCTGG - Intronic
924427644 1:243967731-243967753 CTTCTCAGCTCCTCTCCTACTGG - Intergenic
1064984187 10:21193379-21193401 CATCACTCCTGCACCCCTGCTGG - Intergenic
1064986381 10:21214951-21214973 GTTTATTGCTCCTCCCCGGCAGG - Intergenic
1066093831 10:32054304-32054326 CTTAACTACTCCGCCTCTGCCGG + Intronic
1066550936 10:36555929-36555951 CTACACTGCTCCCCTTCTGCAGG - Intergenic
1067184168 10:44013052-44013074 CTCCTCTGCTTCTCCTCTGCAGG + Intergenic
1067817696 10:49495042-49495064 CTGCACTCCTCCTGCCCTTCTGG + Intronic
1069893979 10:71669123-71669145 CTTCACAGATCTTCCCCTGATGG + Intronic
1070435698 10:76390633-76390655 CTTCATTGCCCCTCCCATCCAGG + Intronic
1071460364 10:85888030-85888052 CTTTACTGTTCCTCACCTCCAGG + Intronic
1072602787 10:96945670-96945692 CTTTACAGCTCCTCTCCTGAAGG + Intronic
1073398250 10:103236162-103236184 CTTCCCTGCAGCTCTCCTGCCGG - Intergenic
1073577626 10:104639562-104639584 CAGCCCTGCTCCTCCCCTTCGGG - Intergenic
1074490834 10:113938258-113938280 CATCTCCGCTCCTCCCCTTCTGG + Intergenic
1074534986 10:114322382-114322404 CTCCCCTGCTCCTGCCATGCTGG + Intronic
1074575361 10:114663826-114663848 TTTCTCTGCACCTCCCCTGACGG + Intronic
1074892760 10:117749103-117749125 CTTTCCAGCTGCTCCCCTGCCGG + Intergenic
1075604932 10:123797931-123797953 CATCAGTGCTCCCACCCTGCAGG + Intronic
1076910180 10:133383985-133384007 CTTCTTTGACCCTCCCCTGCCGG + Exonic
1077144783 11:1040027-1040049 CTTCCCTGCCCCTGCCCCGCTGG + Intergenic
1078245875 11:9573315-9573337 CCTCGCTGCTCCTCCGGTGCTGG - Intergenic
1079458215 11:20655131-20655153 CCTAACTGATCCTCCTCTGCAGG - Exonic
1082808374 11:57463897-57463919 CTTCACTGCCCCAGGCCTGCTGG - Intronic
1083173963 11:60938025-60938047 CGTCTCTGCTCCCCCTCTGCAGG - Exonic
1083488305 11:62997006-62997028 CATCACTCCTCCTGCCCTGATGG + Intronic
1083914394 11:65730742-65730764 CGTGACTGCTCCTGCCATGCAGG - Intergenic
1084155258 11:67309691-67309713 CTTCACCTGCCCTCCCCTGCAGG + Intronic
1084592040 11:70096331-70096353 TTTCTCTCCTCCTCCTCTGCTGG + Intronic
1085780263 11:79401862-79401884 CTTCAGTGTTCCTCCCCGGGTGG - Intronic
1088845568 11:113663281-113663303 CTTCTCTGCTTCTCCCCTTTGGG + Intergenic
1090843888 11:130515207-130515229 CTTCCTTGCTCCTCCCTTGTTGG + Intergenic
1091168415 11:133500563-133500585 CTTCCCACCACCTCCCCTGCAGG + Intronic
1091829906 12:3542251-3542273 CCCCAGTCCTCCTCCCCTGCAGG - Intronic
1092776690 12:11949947-11949969 CCTCCCTGCCCTTCCCCTGCAGG - Intergenic
1094174081 12:27524116-27524138 CTTCTCTCCTCCCTCCCTGCAGG - Intronic
1094486115 12:30926942-30926964 CTCCACTCCTCATCCCCAGCCGG - Exonic
1096095300 12:48931328-48931350 CTCCACTCCTCTTCCCCTTCAGG - Intronic
1096324190 12:50643801-50643823 CTTATCTGCTCCACCTCTGCAGG - Intronic
1096797832 12:54089730-54089752 CTTCACTCCTCCACCCCCGGGGG - Intergenic
1096867875 12:54575970-54575992 CGGCATTGCTCCTCCACTGCAGG + Exonic
1101041424 12:100759787-100759809 GTTCTCTGGGCCTCCCCTGCTGG + Intronic
1101421880 12:104557301-104557323 CTTCACCGCTCATCACCAGCTGG + Intronic
1102964967 12:117118852-117118874 CTTCGCAGCCCCTCCCCTGTGGG + Intergenic
1103340969 12:120221008-120221030 CTGCCCTTCCCCTCCCCTGCTGG - Intronic
1104374118 12:128249104-128249126 CATGACTGCCCCTCCCTTGCAGG - Intergenic
1104682391 12:130760820-130760842 ATTTCCTGCTCCACCCCTGCAGG + Intergenic
1104717548 12:131026116-131026138 CATCTGTGCTTCTCCCCTGCTGG + Intronic
1105065653 12:133195063-133195085 GTTCACTGCTGCTGCCCTCCTGG - Intronic
1105972711 13:25445421-25445443 CTTCACTGATCCTCCAGGGCAGG - Intronic
1107418699 13:40225171-40225193 CTTAATTCCTCCTCCTCTGCTGG - Intergenic
1107718763 13:43226756-43226778 TTTTTCTCCTCCTCCCCTGCAGG + Intronic
1108453142 13:50587158-50587180 CTTCACACCTCTTGCCCTGCTGG - Intronic
1108581747 13:51833921-51833943 CTTCATTGCTCCTCCTCTTTGGG - Intergenic
1112325909 13:98442702-98442724 CTTCCCTGCTCCTCCGCTTCGGG - Intronic
1112617319 13:101018809-101018831 CTCCACAGCTCCTCCCATCCCGG - Intergenic
1112903594 13:104390030-104390052 TATCTCTGCTCCTCCTCTGCAGG - Intergenic
1113007673 13:105725714-105725736 CTCCACTGCTTCTCCAGTGCAGG - Intergenic
1113037141 13:106062564-106062586 CTCCATTGCTGCTCTCCTGCAGG + Intergenic
1113296177 13:108961161-108961183 CTTCACTCCCCCTCCTCTCCAGG - Intronic
1113443962 13:110351409-110351431 CTACCCTGCTCCTCCCTTGCCGG + Intronic
1113586932 13:111472147-111472169 CTTCACTGCCCCTCCAGGGCTGG - Intergenic
1113938116 13:114005810-114005832 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938128 13:114005846-114005868 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938165 13:114005958-114005980 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938177 13:114005994-114006016 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938203 13:114006068-114006090 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938226 13:114006142-114006164 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938237 13:114006178-114006200 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938261 13:114006252-114006274 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938272 13:114006288-114006310 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938322 13:114006438-114006460 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938333 13:114006474-114006496 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938382 13:114006624-114006646 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938393 13:114006660-114006682 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938430 13:114006772-114006794 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938441 13:114006808-114006830 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938465 13:114006882-114006904 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938476 13:114006918-114006940 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938500 13:114006992-114007014 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938535 13:114007104-114007126 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938558 13:114007178-114007200 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938570 13:114007214-114007236 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938605 13:114007307-114007329 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938631 13:114007381-114007403 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1113938642 13:114007417-114007439 CTTCTCCCCTCCTGCCCTGCCGG + Intronic
1113938654 13:114007453-114007475 CTTCTCCCCTCCTGCCCTGCTGG + Intronic
1116368900 14:44104953-44104975 CTTCACTGCCCCTGCCCCACAGG + Intergenic
1117062769 14:51980264-51980286 CTGCAGAGCTCCTCCCCAGCTGG - Intergenic
1119854121 14:77886577-77886599 CTTGCCTGGTCCTCCACTGCTGG - Intronic
1120033033 14:79664231-79664253 CTTCACTGCTCCTCATCTACAGG - Intronic
1121109493 14:91303101-91303123 CTTCCCTGGACCTCCCCTGCAGG - Intronic
1123034484 14:105466365-105466387 CCTGCCTGCCCCTCCCCTGCTGG + Intronic
1123688070 15:22814061-22814083 GTTCACTGCTCCACATCTGCAGG + Intronic
1125299421 15:38238638-38238660 CTTCACATCCCCTACCCTGCAGG + Intergenic
1125742497 15:41975862-41975884 TCCCTCTGCTCCTCCCCTGCTGG - Intergenic
1126376325 15:48000536-48000558 CTTCTCTCCTCCTCCCCAGCAGG + Intergenic
1128105513 15:65041745-65041767 CTTCACAGCTCATGCCCAGCAGG - Intergenic
1128109645 15:65068198-65068220 CTTCTCTGCTCCTTCCCGGCCGG - Intronic
1128550241 15:68593725-68593747 CTTCACAGCTCATCCACTTCTGG - Intronic
1130025194 15:80265059-80265081 CTTCAATGCCACCCCCCTGCTGG - Intergenic
1131027668 15:89158449-89158471 CTTCTCTGCTCTTCAGCTGCTGG - Intronic
1131254910 15:90855575-90855597 CTTTACTGTCCCTCCCCTTCAGG - Intergenic
1132378418 15:101348185-101348207 CTCCGCTGCTCCTCCCCGGTGGG + Intronic
1132579746 16:679558-679580 CTTCTCTGCTCTGCCCCTGATGG + Intronic
1132683076 16:1151867-1151889 CTTCTCTGCTGCTCACCCGCAGG + Intergenic
1133239169 16:4404409-4404431 CCTCCCACCTCCTCCCCTGCAGG + Intronic
1133467407 16:6041111-6041133 CCTCCCTGCTCTCCCCCTGCAGG + Intronic
1133750197 16:8719302-8719324 TTTCACTCCTCCTCCCTTGTAGG + Intronic
1135137991 16:19898766-19898788 CTTAACTGATCCTCCCATCCCGG - Intergenic
1135990491 16:27216031-27216053 CTTCCCCTCTCCTCCCCTCCTGG + Intronic
1137594050 16:49712208-49712230 CTTCTCTGCTCCTCACTTGGAGG + Intronic
1138474246 16:57261359-57261381 CCTCACTTCTACTCCCCTCCTGG + Intronic
1138912920 16:61424575-61424597 CTCCATTCCCCCTCCCCTGCAGG + Intergenic
1139968056 16:70756506-70756528 CTTCCCAGCGCCTACCCTGCTGG + Intronic
1139989409 16:70927558-70927580 TTTGACTGCTCCTGCCCAGCAGG - Intronic
1141297454 16:82783199-82783221 CTGCTCAGCTCCTCCCCTTCAGG + Intronic
1141597763 16:85107737-85107759 CTTCACAGCCCCTGCCCAGCGGG + Intronic
1141618779 16:85225417-85225439 GCTCACTGCTCCAGCCCTGCTGG - Intergenic
1142835196 17:2580398-2580420 CCTCTCTGCTCCTTCCCAGCTGG - Intergenic
1143031945 17:3972875-3972897 CTCCCCTGCCCCTCCCCTGAGGG - Intergenic
1143410198 17:6704056-6704078 CCTCCCTGCCCCTCCTCTGCAGG - Exonic
1143465323 17:7132670-7132692 CATCCCTGCTCCTGCCCAGCTGG + Intergenic
1143528305 17:7484878-7484900 CTTCCCCCCTCCTCCCCTGGCGG + Intronic
1143980319 17:10863502-10863524 CTCCACTGTTTCTCCCCTGCAGG + Intergenic
1144334352 17:14255640-14255662 CTTGATTCCTCTTCCCCTGCTGG + Intergenic
1144951395 17:18996358-18996380 CTCCCCTCCTCCTCCCCTCCAGG + Intronic
1145883847 17:28369566-28369588 CTGCACAGCTCCTCCTCTGCTGG + Exonic
1145956057 17:28855423-28855445 TTTCACTGCTCCTCCCTGTCAGG - Intronic
1145960847 17:28885799-28885821 CTTCTCTCTTCCTGCCCTGCGGG - Intronic
1148447300 17:47745283-47745305 GGTGACAGCTCCTCCCCTGCTGG + Exonic
1148512608 17:48185316-48185338 CTTCTCTTCCCCTTCCCTGCTGG + Intronic
1148807707 17:50272550-50272572 CGTCTCCCCTCCTCCCCTGCAGG - Intronic
1149003703 17:51782838-51782860 CATCACTGCTCTACCACTGCTGG - Intronic
1149582661 17:57762132-57762154 GGCCACTGCCCCTCCCCTGCAGG - Intergenic
1151462103 17:74260512-74260534 CCTCACTGCCACTCCCCTCCTGG - Exonic
1151805029 17:76399921-76399943 CCTCTCTGCTCCGCCCTTGCAGG - Exonic
1154217763 18:12428111-12428133 CTTCACAGCTCCTCTCTGGCAGG + Intronic
1154489867 18:14913037-14913059 CTTCTCTGCTCATCTCATGCTGG - Intergenic
1155334458 18:24750079-24750101 CCTCACTGCTCCATCCCTTCTGG + Intergenic
1155842888 18:30668194-30668216 CTTGACTTCTGCTCACCTGCAGG + Intergenic
1157330045 18:46697077-46697099 CATCTCTCCTCCTCCTCTGCTGG - Intronic
1157725234 18:49958943-49958965 CTCCCCTGCTTCTCCCCTGTGGG + Intronic
1158781907 18:60662627-60662649 TCTCGCAGCTCCTCCCCTGCTGG - Intergenic
1162042211 19:7977818-7977840 CTGCCCCGCTCCTCCCTTGCAGG - Intronic
1163228400 19:15980610-15980632 CTTCTCTGCCCCTCCCTGGCTGG - Intergenic
1165719665 19:38070083-38070105 CTTCCCTGCTCATCCACGGCAGG + Intronic
1165987930 19:39786941-39786963 GTTCACTGCTTCTCTCCTGGGGG - Intergenic
1166108962 19:40611337-40611359 TTTCACTGTGCCTGCCCTGCTGG + Exonic
1166276497 19:41757647-41757669 CTTCTCTGTTCCTCCCCTTGGGG - Intronic
1166781406 19:45345398-45345420 CTTCCCTGCTCCACCCATCCTGG - Intronic
925133774 2:1512526-1512548 CTGCCCCGCTCCGCCCCTGCTGG + Intronic
925171301 2:1751793-1751815 CTTCACTGCTCCTCCCCCATGGG + Intergenic
926694042 2:15758255-15758277 CTTCAGTGCTCCTTCCATCCTGG - Intergenic
927467680 2:23349618-23349640 CTCCCCAGCTCCTCCCCTCCAGG + Intergenic
927704257 2:25287298-25287320 CATCACTTCTCCTCCCGTGGGGG + Intronic
931155343 2:59622263-59622285 CTTGATTGGTCCTCCCTTGCAGG + Intergenic
932667575 2:73709250-73709272 CTTCTCTGTTCCTGCCCTACTGG - Intergenic
933899045 2:86836141-86836163 CCTCCCAGCACCTCCCCTGCTGG - Intronic
933937032 2:87214751-87214773 CTTCAGTGACCCTCCCCTGCTGG + Intergenic
934905306 2:98195825-98195847 TTTCACTGATGCTCCCTTGCTGG + Intronic
934988398 2:98903304-98903326 GTTCACTGCTCCATCCCTGGGGG + Intronic
935152384 2:100449583-100449605 CTCGAATGCTCCTCCTCTGCAGG + Intergenic
935713104 2:105916670-105916692 CTCCACTGCTCCTCTGCTGCGGG + Intergenic
936356110 2:111751073-111751095 CTTCAGTGACCCTCCCCTGCTGG - Intergenic
936441330 2:112556183-112556205 CATCACTGCTCCACCTCTGCTGG - Intronic
938068443 2:128294066-128294088 CCTCTCTGCACCTGCCCTGCTGG + Intronic
938218867 2:129548610-129548632 CTTCACTCAGCCTCCCCGGCAGG + Intergenic
938314054 2:130314479-130314501 CTTCACTGCCCCAGCCCTGATGG - Intergenic
938560293 2:132466556-132466578 CTGGGCTGCTCCTCTCCTGCAGG + Intronic
942320286 2:174730357-174730379 CTCCACAGCCCCTCCCCTCCGGG - Intergenic
942347650 2:175019855-175019877 CTTCACAGATCCTCCCCATCAGG + Intergenic
942491121 2:176490574-176490596 CCTCACAGCTGCTCCCCTCCTGG + Intergenic
945803429 2:214461936-214461958 CTGCACTGCTCGTTCCCTGTAGG + Intronic
947155978 2:227163938-227163960 CTCCACTGCCCCTCCCAGGCAGG + Intronic
947650074 2:231779945-231779967 CTTCAGGGCTCCTCCCTTGGAGG - Intronic
947720918 2:232368677-232368699 CCTCAGTCCTCCTCCCCCGCGGG - Intergenic
948911236 2:241003716-241003738 CTGCACTGCCCCACCTCTGCAGG + Intronic
1169182333 20:3580583-3580605 ATTCACTCCTTCTCACCTGCAGG - Intronic
1169804209 20:9542639-9542661 CTTCAATGAGCCTCCCCTCCAGG - Exonic
1171849673 20:30299558-30299580 CTTCACTCCTCCACCCCCGGGGG - Intergenic
1171952251 20:31430866-31430888 CTTCTCTGCTAATCTCCTGCTGG + Intergenic
1172624064 20:36337373-36337395 CTTCCCTGCACCTACCCAGCGGG - Intronic
1172922745 20:38499584-38499606 CTCCACTGCTCCACCACTGCTGG - Exonic
1173136487 20:40443446-40443468 CTTCACTGTCCCTCACCAGCCGG + Intergenic
1173297604 20:41773072-41773094 GTTCACTCCTCATCCCCTCCTGG - Intergenic
1173461800 20:43248849-43248871 TTGCACTGCTCCACCCCAGCTGG - Intergenic
1175162677 20:57020736-57020758 CCTCCCAGCTCCTCCCCTGCAGG + Intergenic
1175555216 20:59848101-59848123 CTTCCCTCCTCCTTCCCTCCTGG + Intergenic
1175871132 20:62210052-62210074 CCTCCCTGCTCCAGCCCTGCTGG + Intergenic
1176026386 20:62987716-62987738 CCTCACTGTTCCTGTCCTGCAGG - Intergenic
1176186471 20:63782702-63782724 CAACACTGCTCCTCACCTGTGGG - Intronic
1177113602 21:17058767-17058789 CTTCTCTGCTTCTTCCCTCCGGG + Intergenic
1179364009 21:40738948-40738970 CTTCCCAGCTCCAACCCTGCAGG + Intronic
1180947385 22:19704056-19704078 CTTCACAGGTGCTTCCCTGCAGG + Intergenic
1181163189 22:20969457-20969479 GTTCACTCCTTCTCCCATGCTGG + Intronic
1181537507 22:23554224-23554246 CTGCCCTGCTCCCCCCATGCTGG + Intergenic
1182510591 22:30817320-30817342 GGTCACTGCTTCTCCCCTGTGGG + Intronic
1183743280 22:39679815-39679837 CACCACTACTCCTCGCCTGCCGG + Exonic
1184355652 22:43977850-43977872 CCTGAGTGCTCCTTCCCTGCAGG + Exonic
1184683718 22:46086452-46086474 CCCCGCTGCTCCTGCCCTGCTGG - Intronic
949759947 3:7459338-7459360 CCTCTCTGCTCCCCACCTGCTGG - Intronic
950202205 3:11052845-11052867 CTCTACTGCTCTTCCCCTGTTGG + Intergenic
950462371 3:13133090-13133112 CTCCACTGCTCCTGCCCCTCTGG - Intergenic
951507781 3:23467883-23467905 CTTCACTGTCTCTCTCCTGCAGG - Intronic
952902864 3:38121323-38121345 CTTCACTGCTCCTCCTGTGGTGG - Intronic
954108141 3:48420075-48420097 CTTCCCTGCTCAGCCCCTGGGGG - Exonic
954540861 3:51392203-51392225 CGTCGCTGCCCCGCCCCTGCGGG + Exonic
954677888 3:52325652-52325674 CTCCACTACTCCAGCCCTGCAGG - Intronic
956281158 3:67558507-67558529 CCTCACTGTTCTTACCCTGCTGG + Intronic
958524700 3:95240963-95240985 CTGCTCTGCTGCTCCTCTGCTGG + Intergenic
961211604 3:125129971-125129993 CTGCACCCCTCCTCCCCAGCTGG + Intronic
961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG + Intergenic
962386805 3:134938397-134938419 CTTCAGAGCTCGTGCCCTGCTGG + Intronic
962839353 3:139220091-139220113 CTTGACTGCTCTACTCCTGCAGG + Intronic
962845245 3:139268116-139268138 CTTCATGGCTCCTCCTGTGCAGG + Intronic
965755334 3:172020869-172020891 CTTCACTGCTGGAACCCTGCTGG - Intergenic
966828413 3:183984986-183985008 CTTCCCTGCTCCTCCCATCTGGG - Intronic
966885870 3:184377918-184377940 CTGCCCTGCTCCTCCCATTCTGG + Intronic
967326596 3:188246646-188246668 ATTCAGTGCTCCTGCCCTGTGGG - Intronic
968702343 4:2062980-2063002 CACCTCTCCTCCTCCCCTGCCGG + Intronic
968968067 4:3779396-3779418 CAGCCCTGCCCCTCCCCTGCTGG - Intergenic
969644064 4:8416278-8416300 TCTCACAGCTCCTCCTCTGCCGG - Intronic
970188239 4:13484641-13484663 CGTCACTGCTCCACCCCGTCAGG - Intergenic
971422909 4:26490362-26490384 CCTCCCTGCTCCTCCACGGCAGG - Exonic
977202287 4:94131275-94131297 CATCACTTCTCCTGCACTGCAGG + Intergenic
980551023 4:134335423-134335445 CTTCACTGTCCCTTCCATGCTGG + Intergenic
982175283 4:152700427-152700449 CTTCACAGCCCCTCCCTCGCAGG + Intronic
982380649 4:154744216-154744238 CTGCGCTGCTGCTCACCTGCAGG - Exonic
983076229 4:163330967-163330989 ATTCTCTGCTCCTTCCTTGCTGG + Intronic
983278431 4:165648745-165648767 GTTCACTGCTGCTACCATGCTGG - Intergenic
983490985 4:168388800-168388822 TTGCCCTGCCCCTCCCCTGCTGG - Intronic
984598154 4:181695342-181695364 CATCACTGCTCCCCCTCTGTTGG - Intergenic
984908221 4:184649232-184649254 CTTCACTGCTCGCCCCCGCCCGG + Intronic
984915448 4:184719116-184719138 CTCCACTGATTGTCCCCTGCAGG + Intronic
985591625 5:768414-768436 CTCCACTTCTCCACCTCTGCTGG - Intergenic
985609541 5:879373-879395 CTCCACTTCTCCACCTCTGCTGG - Intronic
985638593 5:1052609-1052631 CTGCCCTGCTCCTCCCCGCCTGG - Intronic
985755070 5:1708929-1708951 CTTCCCTCCTCCTCCCCTGCGGG - Intergenic
985849665 5:2379311-2379333 CTTCAGGGCTCTTCTCCTGCAGG + Intergenic
986055874 5:4136156-4136178 GTGCAGTGCTCCTCCTCTGCTGG + Intergenic
986249565 5:6044173-6044195 TTTGTCTCCTCCTCCCCTGCTGG - Intergenic
986584409 5:9299822-9299844 CTTCACGTCTCCTTCCCTGATGG + Intronic
986856429 5:11873960-11873982 CATCACTGCCATTCCCCTGCAGG - Intronic
988652457 5:33167277-33167299 ATTCACTGCCCCTCCACTCCTGG + Intergenic
989564968 5:42892978-42893000 CCTCAGTGTTCTTCCCCTGCAGG + Intergenic
990171285 5:53052826-53052848 CTTTACTGCTCTTCTCCTGTAGG + Intronic
991420079 5:66431526-66431548 CTTCACAAATCCTCCCCAGCTGG - Intergenic
992662494 5:78975189-78975211 CCTGCCTGCTCCTCGCCTGCTGG - Intronic
993095238 5:83472756-83472778 ATCCTCTGCTCCTTCCCTGCTGG - Intronic
994807201 5:104464426-104464448 CCTCAATGATCCTCACCTGCTGG + Intergenic
995525551 5:113047936-113047958 CTTCCTTCCTCCTCCTCTGCCGG + Intronic
996403487 5:123086657-123086679 CTCCCCTGCACCTCCCCAGCAGG - Intergenic
997260500 5:132462485-132462507 CCTCTCTGCTGCTTCCCTGCTGG + Exonic
997473396 5:134129202-134129224 CTGCAGAGCTCCACCCCTGCCGG - Intronic
997610187 5:135210344-135210366 CTGCACTGCTCCTCACTTACTGG - Intronic
999619596 5:153459234-153459256 CTCTACTGCTCCTCCCCTGGAGG + Intergenic
999772220 5:154784259-154784281 CTTATCTGCCCCTCCCCTGGGGG - Intronic
1000795138 5:165655861-165655883 CTTCATTGCTTTCCCCCTGCCGG + Intergenic
1003308807 6:4951000-4951022 ACTCACTGCCCCTCCCATGCAGG - Intronic
1003604418 6:7546043-7546065 CTTCCCTGCTCCTCCAATGGAGG - Intronic
1005900772 6:30214558-30214580 CTTCACCCCTCCTCCGCTGGGGG + Intergenic
1006936424 6:37721766-37721788 CTACAGTGCTCCTACCCTCCTGG - Intergenic
1006967590 6:38004358-38004380 CGTCAGTGTTCCTCCTCTGCAGG + Intronic
1006988649 6:38194246-38194268 CTTCACTTCCCCTCACCTGCTGG - Intronic
1007073192 6:39050840-39050862 CTTCCCTGCTCCTGAACTGCTGG - Intronic
1007369547 6:41417323-41417345 TTTCTCTGTTCCACCCCTGCTGG - Intergenic
1008202104 6:48603215-48603237 ATCCACTGCTCATCCCCTCCTGG - Intergenic
1009833003 6:68963143-68963165 CTGCACTGCTCCTCCCTTACTGG - Intronic
1010635719 6:78256925-78256947 CTTCCCTGCCCCTCCCCTAGTGG - Intergenic
1014079445 6:117270513-117270535 CTCCACTCCGCCTCCCCGGCCGG + Intronic
1014462927 6:121720082-121720104 CTTTACAGCTTCTCCCCAGCTGG + Intergenic
1016183047 6:141170842-141170864 ATTCACTGCTCCACCCCTTGTGG + Intergenic
1016548893 6:145255194-145255216 CTGCACTTCTCCTCCCATGAGGG - Intergenic
1017008716 6:150047269-150047291 CCTCCCTTCTCCTCTCCTGCAGG - Intergenic
1017665103 6:156712459-156712481 CTTCAATCTTCCTTCCCTGCAGG - Intergenic
1018936781 6:168278973-168278995 CGGCCCTGCTCCTCTCCTGCAGG + Intergenic
1019135794 6:169906883-169906905 CTTCCCTGCACATCCTCTGCGGG - Intergenic
1019184582 6:170213675-170213697 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184621 6:170213884-170213906 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184670 6:170214146-170214168 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184678 6:170214199-170214221 CTTCAGTGCTCCCCGCCTTCTGG - Intergenic
1019184689 6:170214252-170214274 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184722 6:170214406-170214428 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184733 6:170214459-170214481 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184754 6:170214564-170214586 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184763 6:170214616-170214638 CTTCAGTGCTCCCCTCCTTCCGG - Intergenic
1019184775 6:170214669-170214691 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184786 6:170214721-170214743 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184796 6:170214773-170214795 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184807 6:170214826-170214848 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184830 6:170214930-170214952 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184839 6:170214982-170215004 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184849 6:170215035-170215057 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184868 6:170215139-170215161 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184877 6:170215191-170215213 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184888 6:170215244-170215266 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184897 6:170215296-170215318 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184906 6:170215348-170215370 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184917 6:170215401-170215423 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184928 6:170215454-170215476 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184981 6:170215711-170215733 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019184992 6:170215764-170215786 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185027 6:170215919-170215941 CTTCAGTGCTCCCCACCTTCCGG - Intergenic
1019185074 6:170216129-170216151 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185121 6:170216337-170216359 CTTCAGTGCTCCCCACCTTCCGG - Intergenic
1019185209 6:170216748-170216770 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185233 6:170216852-170216874 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185264 6:170217009-170217031 CTTCAATGCTCCCCGCCTTCCGG - Intergenic
1019185287 6:170217113-170217135 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185299 6:170217165-170217187 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185308 6:170217217-170217239 CTTCAGTGCTCCCCTCCTTCCGG - Intergenic
1019185320 6:170217270-170217292 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185331 6:170217322-170217344 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185341 6:170217374-170217396 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185352 6:170217427-170217449 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185363 6:170217480-170217502 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185398 6:170217635-170217657 CTTCAGTGCTCCCCACCTTCCGG - Intergenic
1019185445 6:170217845-170217867 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185533 6:170218256-170218278 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185557 6:170218360-170218382 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185589 6:170218517-170218539 CTTCAATGCTCCCCGCCTTCCGG - Intergenic
1019185612 6:170218621-170218643 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185624 6:170218673-170218695 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185633 6:170218725-170218747 CTTCAGTGCTCCCCTCCTTCCGG - Intergenic
1019185645 6:170218778-170218800 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185656 6:170218830-170218852 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185667 6:170218882-170218904 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185678 6:170218935-170218957 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185701 6:170219039-170219061 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185710 6:170219091-170219113 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185720 6:170219144-170219166 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185730 6:170219196-170219218 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185740 6:170219248-170219270 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185768 6:170219404-170219426 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185778 6:170219457-170219479 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185787 6:170219509-170219531 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185798 6:170219562-170219584 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185808 6:170219614-170219636 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185819 6:170219667-170219689 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185828 6:170219719-170219741 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185837 6:170219771-170219793 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185848 6:170219824-170219846 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185859 6:170219877-170219899 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185878 6:170219982-170220004 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185889 6:170220035-170220057 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185900 6:170220088-170220110 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185911 6:170220141-170220163 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185929 6:170220246-170220268 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185940 6:170220299-170220321 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185961 6:170220405-170220427 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185970 6:170220457-170220479 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185979 6:170220509-170220531 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019185990 6:170220562-170220584 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019186001 6:170220615-170220637 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019186020 6:170220717-170220739 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019186030 6:170220769-170220791 CTTCAGTGCTCCCCGCCTTCCGG - Intergenic
1019522222 7:1466174-1466196 CTTCCCTCCGCCTGCCCTGCTGG + Intergenic
1020021762 7:4873553-4873575 CCTCACTGGGCCTGCCCTGCAGG + Intronic
1020077020 7:5265009-5265031 CTTCAGTGATCCTCCCATGTTGG + Intergenic
1022110774 7:27229905-27229927 TTTTGCTGCTCCTCTCCTGCTGG + Intergenic
1022339222 7:29452881-29452903 CTCCACTGCTTCTTCCCTGTGGG + Intronic
1022350965 7:29565911-29565933 CTGCACTGCACTTCCCCTGAAGG + Intronic
1023852031 7:44155824-44155846 CTTGAGTGATCCTCCCTTGCAGG + Intronic
1024111720 7:46154067-46154089 CTTCACAGCTTCTGCTCTGCAGG - Intergenic
1024226306 7:47328773-47328795 CTGCACTGCTCAAACCCTGCAGG + Intronic
1024366717 7:48528786-48528808 GTTCACTGCTCCCACCCTGAAGG - Intronic
1024607806 7:51036994-51037016 TTCCACTGTTCCTTCCCTGCAGG + Intronic
1024879173 7:54066545-54066567 CTTCCCTGCTTCTCTTCTGCAGG + Intergenic
1028964526 7:96787180-96787202 GTTCTTTGCTTCTCCCCTGCTGG - Intergenic
1029439043 7:100577357-100577379 CGCCGCCGCTCCTCCCCTGCCGG + Exonic
1029505816 7:100963579-100963601 CTTCAATTCCCCTCCCCGGCCGG - Intronic
1030744975 7:113153990-113154012 ATTCACTGCTCTTCCACTCCAGG - Intergenic
1031122692 7:117739474-117739496 CAGCCCTGCTCCTCTCCTGCAGG + Intronic
1031318767 7:120293366-120293388 CTTCTCTTCTCCTTCCCTTCTGG - Intronic
1032548054 7:132759757-132759779 CTTCTCTGCTCCTCACCAGGAGG + Intergenic
1034430010 7:151036522-151036544 CCTCACTTCCCCTCTCCTGCAGG + Exonic
1034459046 7:151187814-151187836 CTCCCCTGCGCCTCCCATGCTGG - Intronic
1034563860 7:151898395-151898417 CTCCCCTGCGGCTCCCCTGCCGG - Intergenic
1036692923 8:10956125-10956147 CTTCACAGGTCCTCTCCTGGGGG + Intronic
1036710653 8:11076459-11076481 CGTCACTGCTCCTCTGCTGATGG - Intronic
1037493248 8:19415593-19415615 CTTCGCAACTCCTACCCTGCAGG + Intronic
1038195079 8:25359927-25359949 CTTCACGGCACCTTCCCTTCAGG + Intronic
1038556820 8:28525832-28525854 CTTCTCATTTCCTCCCCTGCTGG - Intronic
1039260566 8:35766880-35766902 CTTCTCTCCGTCTCCCCTGCAGG + Exonic
1040593341 8:48816253-48816275 CATCGCAGCTCCTCTCCTGCTGG - Intergenic
1040783572 8:51139691-51139713 CTTCACTGGTCTGCCCCTTCAGG + Intergenic
1041671057 8:60492396-60492418 CTTCAGTGCCTCTCCCCTGGGGG + Intergenic
1042360927 8:67882349-67882371 CAGCTCTGCTCTTCCCCTGCTGG + Intergenic
1043505468 8:80897781-80897803 CTTCAGGGCTCCTCCCTTGTAGG + Intergenic
1044206455 8:89496745-89496767 CCTCACTGCCTTTCCCCTGCCGG - Intergenic
1046790194 8:118313454-118313476 CTTCCCTCCTCCTTTCCTGCAGG + Intronic
1047372070 8:124264586-124264608 TTTCACTCTTCCTCCCCGGCTGG + Intergenic
1048216074 8:132496495-132496517 CTTAACTGCCCCACCCCTGGTGG - Intergenic
1049370957 8:142266778-142266800 TTTCACTGATCCTCCTCTTCCGG + Intronic
1049424623 8:142532606-142532628 CTCCTCTGCTCCTCCCCTGCTGG + Intronic
1049537410 8:143188781-143188803 CTTCATGGCCCCTCCCCAGCCGG - Intergenic
1049614722 8:143571092-143571114 GTTTCCTGCCCCTCCCCTGCTGG - Intronic
1049740444 8:144238460-144238482 CTATCCTGTTCCTCCCCTGCAGG + Intronic
1050103778 9:2144728-2144750 CTTCACTACTGCCCCCCTGGAGG - Intronic
1052666051 9:31496768-31496790 CTTCACTTCTGCACACCTGCAGG + Intergenic
1052769705 9:32676303-32676325 ATTCTCTGCTCCTCCTCTGCAGG - Intergenic
1053370773 9:37559998-37560020 CTTCACTACTCTTCCCCAGGTGG + Intronic
1053575264 9:39353524-39353546 CTTCATTGCTCCCCCACTGCTGG + Intergenic
1053576153 9:39358434-39358456 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1053787448 9:41662850-41662872 CTTCACTCCTCCACCCCTGGGGG - Intergenic
1053839767 9:42181458-42181480 CTTCATTGCTCCCCCACTGCTGG + Intergenic
1053840670 9:42186371-42186393 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054096826 9:60912207-60912229 CTTCATTGCTCCCCCACTGCTGG + Intergenic
1054097725 9:60917125-60917147 CTTCACTGCTCCTCCCCTGCGGG + Intergenic
1054118230 9:61187833-61187855 CTTCATTGCTCCCCCACTGCTGG + Intergenic
1054119127 9:61192755-61192777 CTTCACTGCTCCTCCCCTGCGGG + Exonic
1054157678 9:61651917-61651939 CTTCACTCCTCCACCCCTGGGGG + Intergenic
1054175724 9:61874189-61874211 CTTCACTCCTCCACCCCTGGGGG - Intergenic
1054477452 9:65582922-65582944 CTTCACTCCTCCACCCCTGGGGG + Intergenic
1054588626 9:66989807-66989829 CTTCACTGCTCCTCCCCTGCGGG - Intergenic
1054589525 9:66994731-66994753 CTTCATTGCTCCCCCACTGCTGG - Intergenic
1054661815 9:67706621-67706643 CTTCACTCCTCCACCCCTGGGGG + Intergenic
1055701278 9:78948153-78948175 CTTGACTTCTGCTCACCTGCAGG - Intergenic
1055986651 9:82060973-82060995 CTTCACTGCTCCTCCCCTGTGGG - Intergenic
1056584752 9:87920612-87920634 CTTCACTCCTCCTCCCCTGCGGG + Intergenic
1056612125 9:88132328-88132350 CTTCACTCCTCCTCCCCTGCGGG - Intergenic
1056928568 9:90855324-90855346 CTTCACCTCCCCTCCCCAGCAGG - Intronic
1057160524 9:92885242-92885264 CTTCACTGCTCCTCCCCTGTGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058035021 9:100242188-100242210 CTTCACTGCTCCTACTCTCAAGG - Intronic
1060736343 9:126068822-126068844 CTGCCCTGATCCTGCCCTGCTGG - Intergenic
1061244482 9:129394365-129394387 CTGCCCTGCTCCCCCCATGCTGG - Intergenic
1061543600 9:131291012-131291034 CTTCCCTGCTCCTTCCCAGGGGG + Intronic
1061738400 9:132679524-132679546 CTTCCTTGCTCCTCTCCTGCAGG - Exonic
1062213936 9:135378921-135378943 CTTCACTGCTGCTCGGCTCCTGG - Intergenic
1062282194 9:135757081-135757103 CCACCCTGCCCCTCCCCTGCTGG + Intronic
1186127040 X:6425677-6425699 ATTCACTGCTCCACCCCTTGTGG + Intergenic
1186421920 X:9433274-9433296 CTTTACAGCTCCTTTCCTGCTGG - Intergenic
1186786019 X:12956424-12956446 AACCACAGCTCCTCCCCTGCCGG + Intergenic
1187272614 X:17792677-17792699 CTAGCCTGTTCCTCCCCTGCAGG + Intergenic
1187358537 X:18602056-18602078 CTTCCCTGCTCCTTCCCTGCAGG - Intronic
1187670191 X:21658724-21658746 CTACACTCCTCCTGCCCAGCCGG - Intergenic
1188756371 X:33968835-33968857 CTGCACTGCTCCCCCGCTGGTGG - Intergenic
1192153243 X:68724740-68724762 CTCCACAGCTCCCCGCCTGCAGG + Exonic
1192320467 X:70086525-70086547 CTCCACTGCTACTTCCCTGAGGG - Intergenic
1194774385 X:97944561-97944583 CCTCACTTCCCCTTCCCTGCTGG + Intergenic
1195011495 X:100736256-100736278 CTTCTCTGCTCCTTCTTTGCAGG + Intergenic
1197765137 X:130055356-130055378 CTCCACGGCTCCCCCTCTGCTGG + Intronic
1197790761 X:130251714-130251736 GTTCACTGCACTTCCCCTTCCGG - Intronic
1200049786 X:153422600-153422622 CTTACCTGCTCCTCCCCATCAGG + Intergenic
1200250073 X:154547940-154547962 CCTCCCTCCTCCTCCACTGCGGG + Intronic
1200255558 X:154580694-154580716 CTTCCCTCCTCCCCGCCTGCAGG + Intergenic
1200262211 X:154623710-154623732 CTTCCCTCCTCCCCGCCTGCAGG - Intergenic
1200831873 Y:7693310-7693332 CTTCACATTTCCTCCCCTGGAGG - Intergenic