ID: 1054137340

View in Genome Browser
Species Human (GRCh38)
Location 9:61439790-61439812
Sequence CTGAAGTTCTCTAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054137340_1054137342 13 Left 1054137340 9:61439790-61439812 CCTTCTTTCCTAGAGAACTTCAG No data
Right 1054137342 9:61439826-61439848 TCTTACAGCCTTCAACTGATTGG 0: 4
1: 15
2: 101
3: 316
4: 656
1054137340_1054137343 19 Left 1054137340 9:61439790-61439812 CCTTCTTTCCTAGAGAACTTCAG No data
Right 1054137343 9:61439832-61439854 AGCCTTCAACTGATTGGATGAGG 0: 32
1: 235
2: 564
3: 821
4: 1049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054137340 Original CRISPR CTGAAGTTCTCTAGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr