ID: 1054137385

View in Genome Browser
Species Human (GRCh38)
Location 9:61440664-61440686
Sequence ACGTCTCTTATTGGTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054137385_1054137387 13 Left 1054137385 9:61440664-61440686 CCTTTAAAACCAATAAGAGACGT No data
Right 1054137387 9:61440700-61440722 TTTAAAGCCATGCAGAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054137385 Original CRISPR ACGTCTCTTATTGGTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr