ID: 1054137791

View in Genome Browser
Species Human (GRCh38)
Location 9:61445207-61445229
Sequence CAGAGATACCAGCTTAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054137791_1054137796 29 Left 1054137791 9:61445207-61445229 CCACAATTAAGCTGGTATCTCTG No data
Right 1054137796 9:61445259-61445281 TTTACTAATTACATTGAATGAGG 0: 4
1: 0
2: 3
3: 23
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054137791 Original CRISPR CAGAGATACCAGCTTAATTG TGG (reversed) Intergenic
No off target data available for this crispr