ID: 1054144299

View in Genome Browser
Species Human (GRCh38)
Location 9:61550765-61550787
Sequence TCAAGTGGCCGCCTTCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054144299_1054144304 9 Left 1054144299 9:61550765-61550787 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054144304 9:61550797-61550819 CTAGGAGCCTTTGTCACACCTGG No data
1054144299_1054144306 20 Left 1054144299 9:61550765-61550787 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054144306 9:61550808-61550830 TGTCACACCTGGCAGTGCACAGG No data
1054144299_1054144302 -9 Left 1054144299 9:61550765-61550787 CCTCTGTGAAGGCGGCCACTTGA No data
Right 1054144302 9:61550779-61550801 GCCACTTGAGGCAGGATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054144299 Original CRISPR TCAAGTGGCCGCCTTCACAG AGG (reversed) Intergenic
No off target data available for this crispr