ID: 1054144846

View in Genome Browser
Species Human (GRCh38)
Location 9:61554726-61554748
Sequence GGTGGCTGTGCAATTTCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054144846_1054144851 14 Left 1054144846 9:61554726-61554748 CCAGACGAAATTGCACAGCCACC No data
Right 1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG No data
1054144846_1054144847 -9 Left 1054144846 9:61554726-61554748 CCAGACGAAATTGCACAGCCACC No data
Right 1054144847 9:61554740-61554762 ACAGCCACCTACCGTGTGAGTGG No data
1054144846_1054144854 22 Left 1054144846 9:61554726-61554748 CCAGACGAAATTGCACAGCCACC No data
Right 1054144854 9:61554771-61554793 GCTGCTTCTGCCTGGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054144846 Original CRISPR GGTGGCTGTGCAATTTCGTC TGG (reversed) Intergenic
No off target data available for this crispr