ID: 1054144848

View in Genome Browser
Species Human (GRCh38)
Location 9:61554744-61554766
Sequence GTTTCCACTCACACGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054144848_1054144851 -4 Left 1054144848 9:61554744-61554766 CCACCTACCGTGTGAGTGGAAAC No data
Right 1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG No data
1054144848_1054144854 4 Left 1054144848 9:61554744-61554766 CCACCTACCGTGTGAGTGGAAAC No data
Right 1054144854 9:61554771-61554793 GCTGCTTCTGCCTGGCCTCTAGG No data
1054144848_1054144857 18 Left 1054144848 9:61554744-61554766 CCACCTACCGTGTGAGTGGAAAC No data
Right 1054144857 9:61554785-61554807 GCCTCTAGGATCCGCATTCAGGG No data
1054144848_1054144856 17 Left 1054144848 9:61554744-61554766 CCACCTACCGTGTGAGTGGAAAC No data
Right 1054144856 9:61554784-61554806 GGCCTCTAGGATCCGCATTCAGG No data
1054144848_1054144859 19 Left 1054144848 9:61554744-61554766 CCACCTACCGTGTGAGTGGAAAC No data
Right 1054144859 9:61554786-61554808 CCTCTAGGATCCGCATTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054144848 Original CRISPR GTTTCCACTCACACGGTAGG TGG (reversed) Intergenic
No off target data available for this crispr