ID: 1054144849

View in Genome Browser
Species Human (GRCh38)
Location 9:61554747-61554769
Sequence TGGGTTTCCACTCACACGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054144849_1054144851 -7 Left 1054144849 9:61554747-61554769 CCTACCGTGTGAGTGGAAACCCA No data
Right 1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG No data
1054144849_1054144854 1 Left 1054144849 9:61554747-61554769 CCTACCGTGTGAGTGGAAACCCA No data
Right 1054144854 9:61554771-61554793 GCTGCTTCTGCCTGGCCTCTAGG No data
1054144849_1054144857 15 Left 1054144849 9:61554747-61554769 CCTACCGTGTGAGTGGAAACCCA No data
Right 1054144857 9:61554785-61554807 GCCTCTAGGATCCGCATTCAGGG No data
1054144849_1054144859 16 Left 1054144849 9:61554747-61554769 CCTACCGTGTGAGTGGAAACCCA No data
Right 1054144859 9:61554786-61554808 CCTCTAGGATCCGCATTCAGGGG No data
1054144849_1054144856 14 Left 1054144849 9:61554747-61554769 CCTACCGTGTGAGTGGAAACCCA No data
Right 1054144856 9:61554784-61554806 GGCCTCTAGGATCCGCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054144849 Original CRISPR TGGGTTTCCACTCACACGGT AGG (reversed) Intergenic
No off target data available for this crispr