ID: 1054144851

View in Genome Browser
Species Human (GRCh38)
Location 9:61554763-61554785
Sequence AAACCCATGCTGCTTCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054144848_1054144851 -4 Left 1054144848 9:61554744-61554766 CCACCTACCGTGTGAGTGGAAAC No data
Right 1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG No data
1054144846_1054144851 14 Left 1054144846 9:61554726-61554748 CCAGACGAAATTGCACAGCCACC No data
Right 1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG No data
1054144849_1054144851 -7 Left 1054144849 9:61554747-61554769 CCTACCGTGTGAGTGGAAACCCA No data
Right 1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054144851 Original CRISPR AAACCCATGCTGCTTCTGCC TGG Intergenic
No off target data available for this crispr