ID: 1054148471

View in Genome Browser
Species Human (GRCh38)
Location 9:61581607-61581629
Sequence TTTCTTTGAAGGAGCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054148464_1054148471 10 Left 1054148464 9:61581574-61581596 CCAGCTCTAACCATGGAATACTG No data
Right 1054148471 9:61581607-61581629 TTTCTTTGAAGGAGCTTTGCTGG No data
1054148467_1054148471 0 Left 1054148467 9:61581584-61581606 CCATGGAATACTGGGAATGTCCC 0: 9
1: 0
2: 2
3: 14
4: 116
Right 1054148471 9:61581607-61581629 TTTCTTTGAAGGAGCTTTGCTGG No data
1054148463_1054148471 11 Left 1054148463 9:61581573-61581595 CCCAGCTCTAACCATGGAATACT 0: 8
1: 2
2: 0
3: 6
4: 105
Right 1054148471 9:61581607-61581629 TTTCTTTGAAGGAGCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054148471 Original CRISPR TTTCTTTGAAGGAGCTTTGC TGG Intergenic
No off target data available for this crispr