ID: 1054153110

View in Genome Browser
Species Human (GRCh38)
Location 9:61621172-61621194
Sequence CTACCTTCAAGAAGCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054153106_1054153110 -9 Left 1054153106 9:61621158-61621180 CCTGACTCCCATTCCTACCTTCA No data
Right 1054153110 9:61621172-61621194 CTACCTTCAAGAAGCTCAGCAGG No data
1054153105_1054153110 14 Left 1054153105 9:61621135-61621157 CCTCTTAACAGTCACAACAGGGA No data
Right 1054153110 9:61621172-61621194 CTACCTTCAAGAAGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054153110 Original CRISPR CTACCTTCAAGAAGCTCAGC AGG Intergenic
No off target data available for this crispr