ID: 1054156347

View in Genome Browser
Species Human (GRCh38)
Location 9:61643448-61643470
Sequence GACCCAGGCATTATTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054156347_1054156352 10 Left 1054156347 9:61643448-61643470 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054156352 9:61643481-61643503 AGATCCAGGTCCCTCTGCTGAGG No data
1054156347_1054156353 11 Left 1054156347 9:61643448-61643470 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054156353 9:61643482-61643504 GATCCAGGTCCCTCTGCTGAGGG No data
1054156347_1054156351 -4 Left 1054156347 9:61643448-61643470 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054156351 9:61643467-61643489 GGTCAAGTTAGGGAAGATCCAGG No data
1054156347_1054156356 20 Left 1054156347 9:61643448-61643470 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054156356 9:61643491-61643513 CCCTCTGCTGAGGGACAGTTTGG No data
1054156347_1054156358 23 Left 1054156347 9:61643448-61643470 CCTGGGGAAATAATGCCTGGGTC No data
Right 1054156358 9:61643494-61643516 TCTGCTGAGGGACAGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054156347 Original CRISPR GACCCAGGCATTATTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr