ID: 1054156462

View in Genome Browser
Species Human (GRCh38)
Location 9:61644318-61644340
Sequence GAACCCAAGTTGGGACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054156462_1054156466 -1 Left 1054156462 9:61644318-61644340 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054156466 9:61644340-61644362 CTACCCTGATCCCTTCCGACAGG No data
1054156462_1054156472 18 Left 1054156462 9:61644318-61644340 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054156472 9:61644359-61644381 CAGGCTCATAGTCTTTCACCTGG No data
1054156462_1054156474 29 Left 1054156462 9:61644318-61644340 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054156474 9:61644370-61644392 TCTTTCACCTGGGCTTTCTCTGG No data
1054156462_1054156475 30 Left 1054156462 9:61644318-61644340 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054156475 9:61644371-61644393 CTTTCACCTGGGCTTTCTCTGGG No data
1054156462_1054156473 19 Left 1054156462 9:61644318-61644340 CCTGCCTGTCCCAACTTGGGTTC No data
Right 1054156473 9:61644360-61644382 AGGCTCATAGTCTTTCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054156462 Original CRISPR GAACCCAAGTTGGGACAGGC AGG (reversed) Intergenic
No off target data available for this crispr