ID: 1054157945

View in Genome Browser
Species Human (GRCh38)
Location 9:61654215-61654237
Sequence CTGGCTACACATTAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054157939_1054157945 19 Left 1054157939 9:61654173-61654195 CCTTATCTCTTGTATTATTTCCT No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157936_1054157945 22 Left 1054157936 9:61654170-61654192 CCCCCTTATCTCTTGTATTATTT No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157934_1054157945 26 Left 1054157934 9:61654166-61654188 CCCTCCCCCTTATCTCTTGTATT No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157938_1054157945 20 Left 1054157938 9:61654172-61654194 CCCTTATCTCTTGTATTATTTCC No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157935_1054157945 25 Left 1054157935 9:61654167-61654189 CCTCCCCCTTATCTCTTGTATTA No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157942_1054157945 -1 Left 1054157942 9:61654193-61654215 CCTAGGGCCTGCATCTCAATCTC No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157944_1054157945 -8 Left 1054157944 9:61654200-61654222 CCTGCATCTCAATCTCTGGCTAC No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data
1054157937_1054157945 21 Left 1054157937 9:61654171-61654193 CCCCTTATCTCTTGTATTATTTC No data
Right 1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054157945 Original CRISPR CTGGCTACACATTAGCAACC TGG Intergenic
No off target data available for this crispr