ID: 1054159326

View in Genome Browser
Species Human (GRCh38)
Location 9:61663044-61663066
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159326_1054159335 23 Left 1054159326 9:61663044-61663066 CCAACTGGGAACACTGTATCTGC No data
Right 1054159335 9:61663090-61663112 GTTGTGTACTTATGGAGGGATGG No data
1054159326_1054159328 -3 Left 1054159326 9:61663044-61663066 CCAACTGGGAACACTGTATCTGC No data
Right 1054159328 9:61663064-61663086 TGCCCTCTAGGAAACCAGCTAGG No data
1054159326_1054159333 18 Left 1054159326 9:61663044-61663066 CCAACTGGGAACACTGTATCTGC No data
Right 1054159333 9:61663085-61663107 GGAGAGTTGTGTACTTATGGAGG No data
1054159326_1054159334 19 Left 1054159326 9:61663044-61663066 CCAACTGGGAACACTGTATCTGC No data
Right 1054159334 9:61663086-61663108 GAGAGTTGTGTACTTATGGAGGG No data
1054159326_1054159332 15 Left 1054159326 9:61663044-61663066 CCAACTGGGAACACTGTATCTGC No data
Right 1054159332 9:61663082-61663104 CTAGGAGAGTTGTGTACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159326 Original CRISPR GCAGATACAGTGTTCCCAGT TGG (reversed) Intergenic