ID: 1054159329

View in Genome Browser
Species Human (GRCh38)
Location 9:61663066-61663088
Sequence CTCCTAGCTGGTTTCCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159329_1054159337 14 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159337 9:61663103-61663125 GGAGGGATGGAGTTACAAAAGGG No data
1054159329_1054159333 -4 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159333 9:61663085-61663107 GGAGAGTTGTGTACTTATGGAGG No data
1054159329_1054159335 1 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159335 9:61663090-61663112 GTTGTGTACTTATGGAGGGATGG No data
1054159329_1054159332 -7 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159332 9:61663082-61663104 CTAGGAGAGTTGTGTACTTATGG No data
1054159329_1054159338 29 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159338 9:61663118-61663140 CAAAAGGGTAAATAGAGCTCAGG No data
1054159329_1054159336 13 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159336 9:61663102-61663124 TGGAGGGATGGAGTTACAAAAGG No data
1054159329_1054159339 30 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159339 9:61663119-61663141 AAAAGGGTAAATAGAGCTCAGGG No data
1054159329_1054159334 -3 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159334 9:61663086-61663108 GAGAGTTGTGTACTTATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159329 Original CRISPR CTCCTAGCTGGTTTCCTAGA GGG (reversed) Intergenic