ID: 1054159330

View in Genome Browser
Species Human (GRCh38)
Location 9:61663067-61663089
Sequence TCTCCTAGCTGGTTTCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159330_1054159332 -8 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159332 9:61663082-61663104 CTAGGAGAGTTGTGTACTTATGG No data
1054159330_1054159337 13 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159337 9:61663103-61663125 GGAGGGATGGAGTTACAAAAGGG No data
1054159330_1054159336 12 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159336 9:61663102-61663124 TGGAGGGATGGAGTTACAAAAGG No data
1054159330_1054159333 -5 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159333 9:61663085-61663107 GGAGAGTTGTGTACTTATGGAGG No data
1054159330_1054159334 -4 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159334 9:61663086-61663108 GAGAGTTGTGTACTTATGGAGGG No data
1054159330_1054159338 28 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159338 9:61663118-61663140 CAAAAGGGTAAATAGAGCTCAGG No data
1054159330_1054159335 0 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159335 9:61663090-61663112 GTTGTGTACTTATGGAGGGATGG No data
1054159330_1054159339 29 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159339 9:61663119-61663141 AAAAGGGTAAATAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159330 Original CRISPR TCTCCTAGCTGGTTTCCTAG AGG (reversed) Intergenic
No off target data available for this crispr