ID: 1054159331

View in Genome Browser
Species Human (GRCh38)
Location 9:61663078-61663100
Sequence AAGTACACAACTCTCCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159331_1054159336 1 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159336 9:61663102-61663124 TGGAGGGATGGAGTTACAAAAGG No data
1054159331_1054159339 18 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159339 9:61663119-61663141 AAAAGGGTAAATAGAGCTCAGGG No data
1054159331_1054159337 2 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159337 9:61663103-61663125 GGAGGGATGGAGTTACAAAAGGG No data
1054159331_1054159338 17 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159338 9:61663118-61663140 CAAAAGGGTAAATAGAGCTCAGG No data
1054159331_1054159340 28 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159340 9:61663129-61663151 ATAGAGCTCAGGGAGCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159331 Original CRISPR AAGTACACAACTCTCCTAGC TGG (reversed) Intergenic