ID: 1054159333

View in Genome Browser
Species Human (GRCh38)
Location 9:61663085-61663107
Sequence GGAGAGTTGTGTACTTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159329_1054159333 -4 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159333 9:61663085-61663107 GGAGAGTTGTGTACTTATGGAGG No data
1054159330_1054159333 -5 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159333 9:61663085-61663107 GGAGAGTTGTGTACTTATGGAGG No data
1054159326_1054159333 18 Left 1054159326 9:61663044-61663066 CCAACTGGGAACACTGTATCTGC No data
Right 1054159333 9:61663085-61663107 GGAGAGTTGTGTACTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159333 Original CRISPR GGAGAGTTGTGTACTTATGG AGG Intergenic