ID: 1054159338

View in Genome Browser
Species Human (GRCh38)
Location 9:61663118-61663140
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159330_1054159338 28 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159338 9:61663118-61663140 CAAAAGGGTAAATAGAGCTCAGG No data
1054159331_1054159338 17 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159338 9:61663118-61663140 CAAAAGGGTAAATAGAGCTCAGG No data
1054159329_1054159338 29 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159338 9:61663118-61663140 CAAAAGGGTAAATAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159338 Original CRISPR CAAAAGGGTAAATAGAGCTC AGG Intergenic
No off target data available for this crispr