ID: 1054159339

View in Genome Browser
Species Human (GRCh38)
Location 9:61663119-61663141
Sequence AAAAGGGTAAATAGAGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159329_1054159339 30 Left 1054159329 9:61663066-61663088 CCCTCTAGGAAACCAGCTAGGAG No data
Right 1054159339 9:61663119-61663141 AAAAGGGTAAATAGAGCTCAGGG No data
1054159330_1054159339 29 Left 1054159330 9:61663067-61663089 CCTCTAGGAAACCAGCTAGGAGA No data
Right 1054159339 9:61663119-61663141 AAAAGGGTAAATAGAGCTCAGGG No data
1054159331_1054159339 18 Left 1054159331 9:61663078-61663100 CCAGCTAGGAGAGTTGTGTACTT No data
Right 1054159339 9:61663119-61663141 AAAAGGGTAAATAGAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159339 Original CRISPR AAAAGGGTAAATAGAGCTCA GGG Intergenic
No off target data available for this crispr