ID: 1054159416

View in Genome Browser
Species Human (GRCh38)
Location 9:61663586-61663608
Sequence CTACAACCCCACCAGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054159416_1054159422 -5 Left 1054159416 9:61663586-61663608 CCTGTGCCCTGGTGGGGTTGTAG No data
Right 1054159422 9:61663604-61663626 TGTAGGATGGGACCAGAATCTGG No data
1054159416_1054159423 -2 Left 1054159416 9:61663586-61663608 CCTGTGCCCTGGTGGGGTTGTAG No data
Right 1054159423 9:61663607-61663629 AGGATGGGACCAGAATCTGGTGG No data
1054159416_1054159427 26 Left 1054159416 9:61663586-61663608 CCTGTGCCCTGGTGGGGTTGTAG No data
Right 1054159427 9:61663635-61663657 GGAGTGAATTTCCAAGTATTGGG No data
1054159416_1054159424 5 Left 1054159416 9:61663586-61663608 CCTGTGCCCTGGTGGGGTTGTAG No data
Right 1054159424 9:61663614-61663636 GACCAGAATCTGGTGGACTGAGG No data
1054159416_1054159426 25 Left 1054159416 9:61663586-61663608 CCTGTGCCCTGGTGGGGTTGTAG No data
Right 1054159426 9:61663634-61663656 AGGAGTGAATTTCCAAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054159416 Original CRISPR CTACAACCCCACCAGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr