ID: 1054162419

View in Genome Browser
Species Human (GRCh38)
Location 9:61683008-61683030
Sequence TTCGGTATGATTTCATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054162419_1054162426 12 Left 1054162419 9:61683008-61683030 CCAGGTGATGAAATCATACCGAA No data
Right 1054162426 9:61683043-61683065 AGATGTCAGCAGAAAATGGCAGG No data
1054162419_1054162425 8 Left 1054162419 9:61683008-61683030 CCAGGTGATGAAATCATACCGAA No data
Right 1054162425 9:61683039-61683061 AGGCAGATGTCAGCAGAAAATGG No data
1054162419_1054162427 13 Left 1054162419 9:61683008-61683030 CCAGGTGATGAAATCATACCGAA No data
Right 1054162427 9:61683044-61683066 GATGTCAGCAGAAAATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054162419 Original CRISPR TTCGGTATGATTTCATCACC TGG (reversed) Intergenic
No off target data available for this crispr