ID: 1054162421

View in Genome Browser
Species Human (GRCh38)
Location 9:61683026-61683048
Sequence ACATCTGCCTCTGGGGTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054162421_1054162427 -5 Left 1054162421 9:61683026-61683048 CCGAAGACCCCAGAGGCAGATGT No data
Right 1054162427 9:61683044-61683066 GATGTCAGCAGAAAATGGCAGGG No data
1054162421_1054162426 -6 Left 1054162421 9:61683026-61683048 CCGAAGACCCCAGAGGCAGATGT No data
Right 1054162426 9:61683043-61683065 AGATGTCAGCAGAAAATGGCAGG No data
1054162421_1054162430 26 Left 1054162421 9:61683026-61683048 CCGAAGACCCCAGAGGCAGATGT No data
Right 1054162430 9:61683075-61683097 CTCACTGCCTCCCTTCATCCTGG 0: 20
1: 55
2: 48
3: 164
4: 620
1054162421_1054162425 -10 Left 1054162421 9:61683026-61683048 CCGAAGACCCCAGAGGCAGATGT No data
Right 1054162425 9:61683039-61683061 AGGCAGATGTCAGCAGAAAATGG No data
1054162421_1054162431 27 Left 1054162421 9:61683026-61683048 CCGAAGACCCCAGAGGCAGATGT No data
Right 1054162431 9:61683076-61683098 TCACTGCCTCCCTTCATCCTGGG 0: 28
1: 52
2: 47
3: 116
4: 464

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054162421 Original CRISPR ACATCTGCCTCTGGGGTCTT CGG (reversed) Intergenic
No off target data available for this crispr