ID: 1054163231

View in Genome Browser
Species Human (GRCh38)
Location 9:61694432-61694454
Sequence CTTTGGGAGGGCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270098
Summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054163225_1054163231 -8 Left 1054163225 9:61694417-61694439 CCAGTAATCCAAGCACTTTGGGA 0: 1640
1: 308977
2: 262533
3: 144042
4: 126798
Right 1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428
1054163222_1054163231 11 Left 1054163222 9:61694398-61694420 CCTGGTGCGATGGCTCATACCAG No data
Right 1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG 0: 7
1: 1361
2: 26677
3: 81625
4: 160428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054163231 Original CRISPR CTTTGGGAGGGCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr