ID: 1054165230

View in Genome Browser
Species Human (GRCh38)
Location 9:61719288-61719310
Sequence ATGCTTACCTTGAAAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1054165229_1054165230 14 Left 1054165229 9:61719251-61719273 CCAATCTAAGAAGAAGAGAAAAG No data
Right 1054165230 9:61719288-61719310 ATGCTTACCTTGAAAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1054165230 Original CRISPR ATGCTTACCTTGAAAGAAAG AGG Intergenic
No off target data available for this crispr